Morpholino

MO1-isl2a

ID
ZDB-MRPHLNO-060728-4
Name
MO1-isl2a
Previous Names
  • MO1-isl2 (1)
Target
Sequence
5' - GGATGCGGTAGAATATCCACCATAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-isl2a
Phenotype
Phenotype resulting from MO1-isl2a
Phenotype of all Fish created by or utilizing MO1-isl2a
Phenotype Fish Conditions Figures
CaP motoneuron axon branchiness, abnormal AB + MO1-isl2a standard conditions Fig. 6 with image from Hutchinson et al., 2006
CaP motoneuron axon extension decreased process quality, abnormal AB + MO1-isl2a standard conditions Fig. 6 with image from Hutchinson et al., 2006
CaP motoneuron axon truncated, abnormal AB + MO1-isl2a standard conditions Fig. 6 with image from Hutchinson et al., 2006
CaP motoneuron axon guidance physical quality of a process, abnormal AB + MO1-isl2a standard conditions Fig. 6 with image from Hutchinson et al., 2006
secondary motor neuron axon decreased amount, abnormal WT + MO1-isl2a standard conditions Fig. 3 with image from Hutchinson et al., 2006
secondary motor neuron decreased amount, abnormal WT + MO1-isl2a standard conditions Fig. 3 with image from Hutchinson et al., 2006
whole organism isl2a expression increased amount, abnormal WT + MO1-isl2a standard conditions Fig. 7 from Moreno et al., 2018
CaP motoneuron axon morphology, abnormal ml2Tg + MO1-isl2a standard conditions Fig. 4 with image from Moreno et al., 2018
CaP motoneuron axon truncated, abnormal ml2Tg + MO1-isl2a standard conditions Fig. 4 with image from Moreno et al., 2018
CaP motoneuron axon GFP expression decreased amount, abnormal ml2Tg + MO1-isl2a standard conditions Fig. 4 with image from Moreno et al., 2018
secondary motor neuron cell body decreased amount, abnormal rw0Tg + MO1-isl2a standard conditions Fig. 5 with image from Moreno et al., 2018
secondary motor neuron axon decreased amount, abnormal rw0Tg + MO1-isl2a standard conditions Fig. 5 with image from Moreno et al., 2018
secondary motor neuron absent, abnormal WT + MO1-isl2a + MO2-isl1a + MO3-isl1a standard conditions Fig. 3 with image from Hutchinson et al., 2006
presumptive sinus venosus cardiac muscle cell ab2-isl labeling absent, abnormal isl1asa29/sa29; s883Tg + MO1-isl2a standard conditions Fig. 2 with image from Witzel et al., 2017
presumptive sinus venosus cardiac muscle cell ab2-isl labeling absent, abnormal isl1asa29/sa29; s883Tg + MO1-isl2a + MO2-isl2b standard conditions Fig. 2 with image from Witzel et al., 2017
Citations