Morpholino

MO1-flt4

ID

ZDB-MRPHLNO-060515-1

Name

MO1-flt4

Previous Names

Flt4 SD1 MO (1)

Target

flt4 (1)

Sequence

5' - TTAGGAAAATGCGTTCTCACCTGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Overlaps the exon 1 splice donor site.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-flt4

No data available

Phenotype

Phenotype resulting from MO1-flt4

Phenotype	Fish	Figures
angiogenesis disrupted, abnormal	y1Tg/y1Tg + MO1-flt4	Fig. 7 from Gore et al., 2011
intersegmental artery blood vessel endothelial cell decreased amount, abnormal	y7Tg + MO1-flt4	Fig. 3 from Siekmann et al., 2007
intersegmental vessel absent, abnormal	y1Tg/y1Tg + MO1-flt4	Fig. 7 from Gore et al., 2011
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal	y7Tg + MO1-flt4	Fig. S5 from Siekmann et al., 2007
motor neuron axon guidance process quality, abnormal	ml2Tg; ncv1Tg + MO1-flt4	Fig. 6 from Kwon et al., 2013
selective angioblast sprouting disrupted, abnormal	WT + MO1-flt4	Fig. 3 from Herbert et al., 2009
venous blood vessel morphogenesis disrupted, abnormal	WT + MO1-flt4	Fig. 3 from Herbert et al., 2009

Phenotype of all Fish created by or utilizing MO1-flt4

Phenotype	Fish	Conditions	Figures
intersegmental vessel absent, abnormal	y1Tg/y1Tg + MO1-flt4	standard conditions	Fig. 7 from Gore et al., 2011
angiogenesis disrupted, abnormal	y1Tg/y1Tg + MO1-flt4	standard conditions	Fig. 7 from Gore et al., 2011
venous blood vessel morphogenesis disrupted, abnormal	WT + MO1-flt4	standard conditions	Fig. 3 from Herbert et al., 2009
selective angioblast sprouting disrupted, abnormal	WT + MO1-flt4	standard conditions	Fig. 3 from Herbert et al., 2009
intersegmental vessel blood vessel endothelial cell decreased amount, abnormal	y7Tg + MO1-flt4	standard conditions	Fig. S5 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell decreased amount, abnormal	y7Tg + MO1-flt4	standard conditions	Fig. 3 from Siekmann et al., 2007
motor neuron axon guidance process quality, abnormal	ml2Tg; ncv1Tg + MO1-flt4	standard conditions	Fig. 6 from Kwon et al., 2013
angiogenesis disrupted, abnormal	y1Tg/y1Tg + MO1-flt4 + MO3-rspo1	standard conditions	Fig. 7 from Gore et al., 2011
intersegmental vessel absent, abnormal	y1Tg/y1Tg + MO1-flt4 + MO3-rspo1	standard conditions	Fig. 7 from Gore et al., 2011
venous blood vessel morphogenesis disrupted, abnormal	WT + MO1-flt4 + MO3-plcg1	standard conditions	Fig. 3 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal	WT + MO1-flt4 + MO3-plcg1	standard conditions	Fig. 3 from Herbert et al., 2009
intersegmental vessel decreased length, abnormal	y1Tg + MO1-dre-mir-221 + MO1-flt4	standard conditions	Fig. 2 from Nicoli et al., 2012
trunk vasculature branchiness, abnormal	sars1^ko095/ko095; y1Tg + MO1-flt4	standard conditions	Fig. 5 from Fukui et al., 2009

Citations