Morpholino

MO1-etsrp

ID
ZDB-MRPHLNO-060407-2
Name
MO1-etsrp
Previous Names
  • MO1-ets1b
  • MO1-etv2
  • etsrp atgMO (1)
Target
Sequence
5' - TTGGTACATTTCCATATCTTAAAGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-etsrp
Phenotype
Phenotype resulting from MO1-etsrp
Phenotype of all Fish created by or utilizing MO1-etsrp
Phenotype Fish Conditions Figures
supraintestinal artery decreased amount, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
extension tal1 expression decreased amount, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
extension inserted into supraintestinal artery, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
supraintestinal artery Kaede expression decreased amount, abnormal ci49Tg/ci49Tg + MO1-etsrp + MO2-etsrp light intensity Fig. 5 from Metikala et al., 2022
lateral plate mesoderm fev expression decreased amount, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
lateral plate mesoderm lmo2 expression decreased amount, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
endothelial cell development disrupted, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
lateral plate mesoderm gata1a expression decreased amount, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
trunk blood vessel runx1 expression decreased amount, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
trunk blood vessel kdrl expression decreased amount, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
lateral plate mesoderm tal1 expression decreased amount, abnormal WT + MO1-etsrp standard conditions Fig. 8 from Pijuan-Sala et al., 2020
myeloid cell differentiation disrupted, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 from Sumanas et al., 2008
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell absent, abnormal WT + MO1-etsrp + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
intersegmental vessel sprouting angiogenesis decreased process quality, abnormal ci6Tg + MO1-etsrp + MO2-etsrp control Fig. 2 from Craig et al., 2015
blood vessel development disrupted, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
blood vasculature lacks parts or has fewer parts of type blood vessel, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
dorsal aorta absent, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
caudal vein plexus EGFP expression decreased amount, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
intersegmental vessel EGFP expression absent, abnormal s843Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. S5 from Reischauer et al., 2016
interrenal primordium bilateral, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
vascular endothelium mislocalised, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
posterior cardinal vein absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
vasculogenesis process quality, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
dorsal aorta absent, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
interrenal primordium left side unfused from interrenal primordium right side, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
dorsal aorta decreased size, abnormal y1Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 2 with image from Chou et al., 2010
axial vasculature apoptotic process increased process quality, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 6 from Craig et al., 2015
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intestine decreased size, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
dorsal aorta absent, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
blood vessel development disrupted, abnormal zf346Tg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chou et al., 2013
intermediate cell mass of mesoderm gata1a expression amount, ameliorated kdm1ait627/it627 + MO1-etsrp (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
posterior lateral plate mesoderm gata1a expression amount, ameliorated kdm1ait627/it627 + MO1-etsrp (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression mislocalised, abnormal AB + MO1-etsrp + MO1-gata1a standard conditions Fig. 4 with image from Takeuchi et al., 2015
intermediate cell mass of mesoderm spi1b expression position, ameliorated kdm1ait627/it627 + MO1-etsrp + MO1-gata1a (AB) standard conditions Fig. 4 with image from Takeuchi et al., 2015
endothelial cell absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell cdh5 expression absent, abnormal WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardium fused with myocardium, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated WT + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
dorsal longitudinal anastomotic vessel hypoplastic, abnormal y1Tg + MO1-erg + MO1-etsrp standard conditions Fig. 4 with image from Ellett et al., 2009
intersegmental vessel hypoplastic, abnormal y1Tg + MO1-erg + MO1-etsrp standard conditions Fig. 4 with image from Ellett et al., 2009
blood vasculature disorganized, abnormal y1Tg + MO1-erg + MO1-etsrp standard conditions Fig. 4 with image from Ellett et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO1-erg + MO1-etsrp standard conditions Fig. 4 with image from Ellett et al., 2009
skeletal muscle cell differentiation increased occurrence, abnormal etsrpci32Gt/+; nkuasgfp1aTg + MO1-etsrp + MO2-etsrp standard conditions Fig. 3 with image from Chestnut et al., 2020
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1rstpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1rstpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1rstpl50Gt/+; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature apoptotic process increased process quality, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 6 from Craig et al., 2015
intersegmental vessel sprouting angiogenesis arrested, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature malformed, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
vasculogenesis process quality, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
axial vasculature vasculogenesis process quality, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
intersegmental vessel absent, abnormal fli1rstpl50Gt/tpl50Gt; y1Tg + MO1-etsrp + MO2-etsrp control Fig. 3 from Craig et al., 2015
endothelial cell absent, abnormal fb9Tg; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
endothelial cell EGFP expression absent, abnormal fb9Tg; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
myocardial precursor cardioblast migration to the midline involved in heart field formation occurrence, ameliorated fb9Tg; y1Tg + MO1-etsrp + MO1-gna13a + MO1-gna13b + MO2-etsrp standard conditions Fig. 8 with image from Xie et al., 2016
Citations