Morpholino

MO1-cyp11a1.1

ID
ZDB-MRPHLNO-060301-3
Name
MO1-cyp11a1.1
Previous Names
  • MO1-cyp11a1
  • scc mo1 (1)
Target
Sequence
5' - GCCATCACACTCTCTCTCTCTACTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp11a1.1
Expressed Gene Anatomy Figures
gsc Fig. S3 from Hsu et al., 2006
shha Fig. S2,  Fig. S3 from Hsu et al., 2006
sox17 Fig. S3 from Hsu et al., 2006
tbx16l Fig. S3 from Hsu et al., 2006
tbxta Fig. S2 from Hsu et al., 2006
Phenotype
Phenotype resulting from MO1-cyp11a1.1
Phenotype Fish Figures
axis decreased length, abnormal WT + MO1-cyp11a1.1 Fig. 3 from Hsu et al., 2006
Fig. 2,  Fig. S2 from Hsu et al., 2006
epiboly arrested, abnormal AB + MO1-cyp11a1.1 Fig. 3 from Parajes et al., 2013
epiboly involved in gastrulation with mouth forming second delayed, abnormal TL + MO1-cyp11a1.1 Fig. 6 from Weng et al., 2013
Fig. 2,  Fig. S2 from Hsu et al., 2006
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-cyp11a1.1 Fig. 3 from Hsu et al., 2006
extension decreased length, abnormal WT + MO1-cyp11a1.1 Fig. 3 from Hsu et al., 2006
whole organism dead, abnormal AB + MO1-cyp11a1.1 Fig. 3 from Parajes et al., 2013
whole organism decreased length, abnormal WT + MO1-cyp11a1.1 Fig. 3 from Hsu et al., 2006
yolk microtubule decreased thickness, abnormal WT + MO1-cyp11a1.1 Fig. 3 from Hsu et al., 2006
Phenotype of all Fish created by or utilizing MO1-cyp11a1.1
Phenotype Fish Conditions Figures
whole organism dead, abnormal AB + MO1-cyp11a1.1 standard conditions Fig. 3 from Parajes et al., 2013
epiboly arrested, abnormal AB + MO1-cyp11a1.1 standard conditions Fig. 3 from Parajes et al., 2013
epiboly involved in gastrulation with mouth forming second delayed, abnormal TL + MO1-cyp11a1.1 standard conditions Fig. 6 from Weng et al., 2013
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-cyp11a1.1 standard conditions Fig. 3 from Hsu et al., 2006
axis decreased length, abnormal WT + MO1-cyp11a1.1 standard conditions Fig. 3 from Hsu et al., 2006
Fig. 2,  Fig. S2 from Hsu et al., 2006
extension decreased length, abnormal WT + MO1-cyp11a1.1 standard conditions Fig. 3 from Hsu et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal WT + MO1-cyp11a1.1 standard conditions Fig. 2,  Fig. S2 from Hsu et al., 2006
yolk microtubule decreased thickness, abnormal WT + MO1-cyp11a1.1 standard conditions Fig. 3 from Hsu et al., 2006
whole organism decreased length, abnormal WT + MO1-cyp11a1.1 standard conditions Fig. 3 from Hsu et al., 2006
epiboly involved in gastrulation with mouth forming second delayed, abnormal TL + MO1-clip1a + MO1-cyp11a1.1 standard conditions Fig. 6 from Weng et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.