Morpholino

MO1-ahr1a

ID
ZDB-MRPHLNO-060104-4
Name
MO1-ahr1a
Previous Names
  • E2I2-MO (1)
Target
Sequence
5' - CTTTTGAAGTGACTTTTGGCCCGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ahr1a
No data available
Phenotype
Phenotype resulting from MO1-ahr1a
No data available
Phenotype of all Fish created by or utilizing MO1-ahr1a
Phenotype Fish Conditions Figures
whole organism cyp1c1 expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 6 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
whole organism cyp1b1 expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 6 from Garner et al., 2013
whole organism cyp1b1 expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 4 from Garner et al., 2013
pericardium morphology, exacerbated EKW + MO1-ahr1a chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 1,  Fig. 2 from Garner et al., 2013
whole organism cyp1c1 expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 4 from Garner et al., 2013
whole organism cyp1a expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 5 from Garner et al., 2013
pericardium morphology, abnormal EKW + MO1-ahr1a chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 3 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
pericardium morphology, exacerbated EKW + MO1-ahr1a chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 8 from Garner et al., 2013
whole organism cyp1a expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 6 from Garner et al., 2013
pericardium morphology, abnormal EKW + MO1-ahr1a chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 2 from Garner et al., 2013
whole organism cyp1c1 expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 5 from Garner et al., 2013
whole organism cyp1b1 expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 5 from Garner et al., 2013
whole organism cyp1a expression increased amount, abnormal EKW + MO1-ahr1a chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 4 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a + MO1-ahr2 chemical treatment by environment: benzo[a]pyrene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a + MO1-ahr2 chemical treatment by environment: Benzo[k]fluoranthene, chemical treatment by environment: fluoranthene Fig. 7 from Garner et al., 2013
pericardium morphology, ameliorated EKW + MO1-ahr1a + MO1-ahr2 chemical treatment by environment: 3,3',4,4',5-pentachlorobiphenyl Fig. 8 from Garner et al., 2013
pericardium edematous, ameliorated ahr2hu3335/hu3335 + MO1-ahr1a + MO1-ahr1b chemical treatment: aryl hydrocarbon receptor agonist Fig. 2 from Gerlach et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.