Morpholino

MO1-nkx3-2

ID

ZDB-MRPHLNO-051221-6

Name

MO1-nkx3-2

Previous Names

bapx1-MO (1)
MO1-bapx1 (1)
MO1-nkx3-2 (1)
MO1-nkx3.2

Target

nkx3-2 (1)

Sequence

5' - GCGCACAGCCATGTCGAGCAGCACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-nkx3-2

No data available

Phenotype

Phenotype resulting from MO1-nkx3-2

Phenotype	Fish	Figures
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO1-nkx3-2	Fig. 4 from Miller et al., 2003
embryonic viscerocranium morphogenesis process quality, abnormal	WT + MO1-nkx3-2	Fig. 9 from Miller et al., 2004
Meckel's cartilage malformed, abnormal	WT + MO1-nkx3-2	Fig. 9 from Miller et al., 2004 Fig. 4 from Miller et al., 2003
Meckel's cartilage joint absent, abnormal	WT + MO1-nkx3-2	Fig. 9 from Miller et al., 2004
Meckel's cartilage-palatoquadrate cartilage joint absent, abnormal	el10Tg/+ + MO1-nkx3-2	Fig. 4 from Smeeton et al., 2021
mouth open, abnormal	el10Tg/+ + MO1-nkx3-2	Fig. 4 from Smeeton et al., 2021
palatoquadrate cartilage malformed, abnormal	WT + MO1-nkx3-2	Fig. 9 from Miller et al., 2004
pharyngeal arch 1 joint absent, abnormal	WT + MO1-nkx3-2	Fig. 4 from Miller et al., 2003

Phenotype of all Fish created by or utilizing MO1-nkx3-2

Phenotype	Fish	Conditions	Figures
embryonic viscerocranium morphogenesis process quality, abnormal	WT + MO1-nkx3-2	standard conditions	Fig. 9 from Miller et al., 2004
palatoquadrate cartilage malformed, abnormal	WT + MO1-nkx3-2	standard conditions	Fig. 9 from Miller et al., 2004
pharyngeal arch 1 joint absent, abnormal	WT + MO1-nkx3-2	standard conditions	Fig. 4 from Miller et al., 2003
Meckel's cartilage malformed, abnormal	WT + MO1-nkx3-2	standard conditions	Fig. 9 from Miller et al., 2004 Fig. 4 from Miller et al., 2003
embryonic viscerocranium morphogenesis disrupted, abnormal	WT + MO1-nkx3-2	standard conditions	Fig. 4 from Miller et al., 2003
Meckel's cartilage joint absent, abnormal	WT + MO1-nkx3-2	standard conditions	Fig. 9 from Miller et al., 2004
Meckel's cartilage-palatoquadrate cartilage joint absent, abnormal	el10Tg/+ + MO1-nkx3-2	standard conditions	Fig. 4 from Smeeton et al., 2021
mouth open, abnormal	el10Tg/+ + MO1-nkx3-2	standard conditions	Fig. 4 from Smeeton et al., 2021
ceratohyal cartilage joint absent, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004
Meckel's cartilage joint absent, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004
hyosymplectic cartilage malformed, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004
palatoquadrate cartilage malformed, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004
Meckel's cartilage malformed, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004
ceratohyal cartilage malformed, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004
embryonic viscerocranium morphogenesis process quality, abnormal	kat6a^b719/b719 + MO1-nkx3-2 (AB)	standard conditions	Fig. 9 from Miller et al., 2004

Citations