Morpholino

MO3-plcg1

ID
ZDB-MRPHLNO-051214-1
Name
MO3-plcg1
Previous Names
  • MO4-plcg1
Target
Sequence
5' - ATTAGCATAGGGAACTTACTTTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This morpholino sequence is based on sequence of the intron-exon boundaries of the plcg1 gene in the Tg(fli1:EGFP)y1 (EK) line. The mismatch with Ensembl builds (Zv5, Zv8) may reflect a polymorphism.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-plcg1
Expressed Gene Anatomy Figures
arap3 Fig. 2 from Kartopawiro et al., 2014
cdh5 Fig. 6 with image from Jin et al., 2005
myb Fig. 4 from Burns et al., 2009
runx1 Fig. 4 from Burns et al., 2009
tek Fig. 2 from Hogan et al., 2009
Phenotype
Phenotype resulting from MO3-plcg1
Phenotype Fish Figures
angiogenesis disrupted, abnormal y1Tg + MO3-plcg1 Fig. 4 from Pan et al., 2012
Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO3-plcg1 Fig. 2 from Hogan et al., 2009
blood circulation arrested, abnormal WT + MO3-plcg1 Fig. 1 from Ma et al., 2007
blood vessel morphogenesis disrupted, abnormal WT + MO3-plcg1 Fig. 2 from Herbert et al., 2009
dorsal aorta aplastic, abnormal WT + MO3-plcg1 Fig. 2 from Herbert et al., 2009
heart edematous, abnormal WT + MO3-plcg1 Fig. 1 from Ma et al., 2007
intersegmental vessel aplastic, abnormal WT + MO3-plcg1 Fig. 2,  Fig. 3 from Herbert et al., 2009
Fig. 2 from Hogan et al., 2009
intersegmental vessel decreased length, abnormal y1Tg + MO3-plcg1 Fig. 4 from Pan et al., 2012
nucleate erythrocyte decreased amount, abnormal WT + MO3-plcg1 Fig. 1 from Ma et al., 2007
sprouting angiogenesis disrupted, abnormal WT + MO3-plcg1 Fig. 2 from Herbert et al., 2009
Phenotype of all Fish created by or utilizing MO3-plcg1
Phenotype Fish Conditions Figures
intersegmental vessel aplastic, abnormal WT + MO3-plcg1 standard conditions Fig. 2,  Fig. 3 from Herbert et al., 2009
blood circulation arrested, abnormal WT + MO3-plcg1 standard conditions Fig. 1 from Ma et al., 2007
heart edematous, abnormal WT + MO3-plcg1 standard conditions Fig. 1 from Ma et al., 2007
angiogenesis disrupted, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
dorsal aorta aplastic, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Herbert et al., 2009
nucleate erythrocyte decreased amount, abnormal WT + MO3-plcg1 standard conditions Fig. 1 from Ma et al., 2007
sprouting angiogenesis disrupted, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Herbert et al., 2009
blood vessel morphogenesis disrupted, abnormal WT + MO3-plcg1 standard conditions Fig. 2 from Herbert et al., 2009
artery aplastic, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
angiogenesis disrupted, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 4 from Pan et al., 2012
intersegmental vessel decreased length, abnormal y1Tg + MO3-plcg1 standard conditions Fig. 4 from Pan et al., 2012
parachordal vessel immature, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
parachordal vessel venous endothelial cell migration involved in lymph vessel development arrested, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
branching involved in lymph vessel morphogenesis process quality, abnormal y1Tg/+ + MO1-dcc + MO3-plcg1 standard conditions Fig. 4 with image from Lim et al., 2011
venous blood vessel morphogenesis disrupted, abnormal WT + MO1-flt4 + MO3-plcg1 standard conditions Fig. 3 from Herbert et al., 2009
intersegmental vessel aplastic, abnormal WT + MO1-flt4 + MO3-plcg1 standard conditions Fig. 3 from Herbert et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-ccbe1 + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
artery aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
lymphangiogenesis disrupted, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
intersegmental vessel aplastic, abnormal y1Tg + MO1-vegfc + MO2-vegfc + MO3-plcg1 standard conditions Fig. 2 from Hogan et al., 2009
sprouting angiogenesis disrupted, abnormal grb2bhu6987/hu6987; y1Tg + MO3-plcg1 standard conditions Fig. 7 with image from Mauri et al., 2021
ventral wall of dorsal aorta hematopoietic stem cell absent, abnormal kca3Tg; kca4Tg + MO3-plcg1 standard conditions Fig. 4 from Burns et al., 2009
hematopoietic stem cell differentiation disrupted, abnormal kca3Tg; kca4Tg + MO3-plcg1 standard conditions Fig. 4 from Burns et al., 2009
posterior cardinal vein vascular sprouts decreased amount, abnormal svep1hu4767/+; y1Tg + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
artery development disrupted, abnormal svep1hu4767/+; y1Tg + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
posterior cardinal vein vascular sprouts decreased amount, abnormal svep1hu4767/hu4767; y1Tg + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
artery development disrupted, abnormal svep1hu4767/hu4767; y1Tg + MO3-plcg1 standard conditions Fig. 3 with image from Kärpanen et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.