Morpholino

MO3-cxcl12a

ID

ZDB-MRPHLNO-051028-2

Name

MO3-cxcl12a

Previous Names

SDF-1a-1-MO (1)

Target

cxcl12a (1)

Sequence

5' - CTACTACGATCACTTTGAGATCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking morpholino

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-cxcl12a

Expressed Gene	Anatomy	Figures
pax2a	midbrain hindbrain boundary neural rod	Fig. 3 from Lewellis et al., 2013

Phenotype

Phenotype resulting from MO3-cxcl12a

Phenotype	Fish	Figures
cell migration involved in gastrulation delayed, abnormal	ha01Tg + MO3-cxcl12a	Fig. S2 from Mizoguchi et al., 2008
hematopoietic system vasculature increased amount, abnormal	pd27Tg; zf741Tg + MO3-cxcl12a	Fig. 7 from Theodore et al., 2017
primordial germ cell mislocalised, abnormal	er1Tg + MO3-cxcl12a	Fig. 4 from Boldajipour et al., 2008

Phenotype of all Fish created by or utilizing MO3-cxcl12a

Phenotype	Fish	Conditions	Figures
primordial germ cell mislocalised, abnormal	er1Tg + MO3-cxcl12a	standard conditions	Fig. 4 from Boldajipour et al., 2008
cell migration involved in gastrulation delayed, abnormal	ha01Tg + MO3-cxcl12a	standard conditions	Fig. S2 from Mizoguchi et al., 2008
hematopoietic system vasculature increased amount, abnormal	pd27Tg; zf741Tg + MO3-cxcl12a	control	Fig. 7 from Theodore et al., 2017
hematopoietic system posterior region has number of hematopoietic multipotent progenitor cell, ameliorated	pd27Tg; zf741Tg + MO3-cxcl12a	chemical treatment by environment: MMP9 inhibitor I	Fig. 7 from Theodore et al., 2017
hematopoietic system posterior region EGFP expression amount, ameliorated	pd27Tg; zf741Tg + MO3-cxcl12a	chemical treatment by environment: MMP9 inhibitor I	Fig. 7 from Theodore et al., 2017
hematopoietic system vasculature amount, ameliorated	pd27Tg; zf741Tg + MO3-cxcl12a	chemical treatment by environment: MMP9 inhibitor I	Fig. 7 from Theodore et al., 2017
pancreas morphology, abnormal	WT + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
gut morphology, abnormal	WT + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal	WT + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
pancreas pancreatic B cell dispersed, abnormal	WT + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
pancreas decreased size, abnormal	WT + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
liver decreased size, abnormal	WT + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
endodermal cell filopodium decreased amount, abnormal	ha01Tg + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 6 from Mizoguchi et al., 2008
endodermal cell circular, abnormal	ha01Tg + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 6 from Mizoguchi et al., 2008
gut bifurcated, abnormal	ha01Tg + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 from Mizoguchi et al., 2008
cell migration involved in gastrulation delayed, abnormal	ha01Tg + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 2 , Fig. S2 from Mizoguchi et al., 2008
cell migration involved in gastrulation process quality, abnormal	ha01Tg + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 6 from Mizoguchi et al., 2008
endodermal cell filopodium orientation whole organism dorsal-ventral axis, abnormal	ha01Tg + MO1-cxcl12b + MO3-cxcl12a	standard conditions	Fig. 6 from Mizoguchi et al., 2008
thymus lacks parts or has fewer parts of type lymphocyte, abnormal	fr101Tg; fr103Tg + MO2-ccl25a + MO3-cxcl12a	standard conditions	Fig. 6 from Hess et al., 2012
lymphoid lineage cell migration into thymus disrupted, abnormal	fr101Tg; fr103Tg + MO2-ccl25a + MO3-cxcl12a	standard conditions	Fig. 6 from Hess et al., 2012
hematopoietic stem cell migration increased process quality, abnormal	myb^hkz3/hkz3; la2Tg + MO3-cxcl12a	standard conditions	Fig. 5 from Zhang et al., 2011

Citations