Morpholino

MO1-ctnnb1

ID

ZDB-MRPHLNO-051024-1

Name

MO1-ctnnb1

Previous Names

None

Target

ctnnb1 (1)

Sequence

5' - ATCAAGTCAGACTGGGTAGCCATGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ctnnb1

Expressed Gene	Anatomy	Figures
chrd	marginal blastomere whole organism	Fig 4 from He et al., 2020 Fig. 5 from Lyman Gingerich et al., 2005
dharma	whole organism	Fig 4 from He et al., 2020
dnah9	forerunner cell group	Fig. 2 from Caron et al., 2012
fabp2	(not) intestinal epithelium	Fig. 7 from Rottbauer et al., 2002
fabp10a	liver	Fig. 2 from Goessling et al., 2008
myl7	heart	Fig. 7 from Rottbauer et al., 2002

Phenotype

Phenotype resulting from MO1-ctnnb1

Phenotype	Fish	Figures
brain decreased size, abnormal	w25Tg + MO1-ctnnb1	Fig. S5 from Upadhyay et al., 2008
brain morphology, abnormal	w25Tg + MO1-ctnnb1	Fig. S5 from Upadhyay et al., 2008
post-vent region decreased length, abnormal	w25Tg + MO1-ctnnb1	Fig. S5 from Upadhyay et al., 2008
whole organism decreased size, abnormal	w25Tg + MO1-ctnnb1	Fig. S5 from Upadhyay et al., 2008

Phenotype of all Fish created by or utilizing MO1-ctnnb1

Phenotype	Fish	Conditions	Figures
whole organism decreased size, abnormal	w25Tg + MO1-ctnnb1	standard conditions	Fig. S5 from Upadhyay et al., 2008
brain morphology, abnormal	w25Tg + MO1-ctnnb1	standard conditions	Fig. S5 from Upadhyay et al., 2008
post-vent region decreased length, abnormal	w25Tg + MO1-ctnnb1	standard conditions	Fig. S5 from Upadhyay et al., 2008
brain decreased size, abnormal	w25Tg + MO1-ctnnb1	standard conditions	Fig. S5 from Upadhyay et al., 2008
liver decreased size, abnormal	apc^hu745/+ + MO1-ctnnb1	standard conditions	Fig. S1 from Goessling et al., 2008
liver increased size, ameliorated	apc^hu745/+ + MO1-ctnnb1	standard conditions	Fig. 2 from Goessling et al., 2008
liver absent, abnormal	apc^hu745/hu745 + MO1-ctnnb1	standard conditions	Fig. 2 from Goessling et al., 2008
liver decreased size, abnormal	apc^hu745/hu745 + MO1-ctnnb1	standard conditions	Fig. S1 from Goessling et al., 2008
whole organism dharma expression increased distribution, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
canonical Wnt signaling pathway increased efficacy, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism chrd expression increased amount, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism dorsalized, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism chrd expression increased distribution, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
negative regulation of canonical Wnt signaling pathway decreased occurrence, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism dharma expression increased amount, abnormal	nanog^ihb97/ihb97 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism dharma expression increased distribution, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism dorsalized, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism chrd expression increased distribution, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism chrd expression increased amount, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
canonical Wnt signaling pathway increased efficacy, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
whole organism dharma expression increased amount, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
negative regulation of canonical Wnt signaling pathway decreased occurrence, abnormal	nanog^ihb98/ihb98 + MO1-ctnnb1	standard conditions	Fig 4 from He et al., 2020
digestive tract development disrupted, abnormal	ruvbl2^fw039k/+ + MO1-ctnnb1	standard conditions	Fig. 7 from Rottbauer et al., 2002
cardiac ventricle hyperplastic, abnormal	ruvbl2^fw039k/+ + MO1-ctnnb1	standard conditions	Fig. 7 from Rottbauer et al., 2002
digestive tract development disrupted, abnormal	ruvbl2^{fw039k/fw039k} + MO1-ctnnb1	standard conditions	Fig. 7 from Rottbauer et al., 2002
cardiac ventricle hyperplastic, abnormal	ruvbl2^{fw039k/fw039k} + MO1-ctnnb1	standard conditions	Fig. 7 from Rottbauer et al., 2002
trunk vasculature dll4 expression amount, ameliorated	WT + MO1-ctnnb1 + MO1-ctnnb2 + MO1-ptger3	standard conditions	Fig. 4 from Chen et al., 2017

Citations