Morpholino

MO4-tbx2b

ID
ZDB-MRPHLNO-051012-1
Name
MO4-tbx2b
Previous Names
  • Tbx2b-SP (1)
Target
Sequence
5' - AAAATATGGGTACATACCTTGTCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a splice blocking morpholino targeting the tbx2b gene.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-tbx2b
Expressed Gene Anatomy Figures
efnb2a Fig. 5 from Gross et al., 2005
gfi1ab Fig. 7 with image from Clanton et al., 2013
gngt1 Fig. 6 from Khuansuwan et al., 2014
gngt2a Fig. 6 from Khuansuwan et al., 2014
msx3 Fig. 5 from Gross et al., 2005
ndrg4 Fig. 11 with image from Sedletcaia et al., 2011
nppa Fig. 11 with image from Sedletcaia et al., 2011
otomp Fig. 6 from Khuansuwan et al., 2014
otx5 Fig. 6 from Khuansuwan et al., 2014
pax2a Fig. 5 from Gross et al., 2005
rdh5 Fig. 6 from Khuansuwan et al., 2014
rgra Fig. 6 from Khuansuwan et al., 2014
sim1a Fig. 4 with image from Drummond et al., 2017
slc12a1 Fig. 3 with image from Drummond et al., 2017
slc12a3 Fig. 3 with image from Drummond et al., 2017
slc20a1a Fig. 3 with image from Drummond et al., 2017
smyhc1 Fig. 3 with image,  Fig. 7 with image from Drummond et al., 2017
stc1 Fig. 4 with image from Drummond et al., 2017
tbx2a Fig. 7 with image from Drummond et al., 2017
tbx2b Fig. 2 from Gross et al., 2005
tbx5a Fig. 5 from Gross et al., 2005
trpm7 Fig. 3 with image from Drummond et al., 2017
vax2 Fig. 5 from Gross et al., 2005
Phenotype
Phenotype resulting from MO4-tbx2b
Phenotype Fish Figures
atrioventricular canal development disrupted, abnormal twu26Tg + MO4-tbx2b Fig. 4 with image from Sedletcaia et al., 2011
cell migration in diencephalon disrupted, abnormal zf104Tg + MO4-tbx2b Fig. 8 with image from Snelson et al., 2008
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO4-tbx2b Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO4-tbx2b Fig. 4 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO4-tbx2b Fig. 4 with image from Drummond et al., 2017
epithalamus development disrupted, abnormal zf104Tg + MO4-tbx2b Fig. 8 with image from Snelson et al., 2008
heart looping disrupted, abnormal twu26Tg + MO4-tbx2b Fig. 4 with image from Sedletcaia et al., 2011
parapineal organ has fewer parts of type parapineal organ neuron, abnormal sqet11Et + MO4-tbx2b Fig. 4 with image from Khuansuwan et al., 2016
parapineal organ has fewer parts of type cell, abnormal WT + MO4-tbx2b Fig. 7 with image from Clanton et al., 2013
parapineal organ neuron fate specification decreased occurrence, abnormal sqet11Et + MO4-tbx2b Fig. 4 with image from Khuansuwan et al., 2016
pineal complex gngt1 expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex otx5 expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex otomp expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex rdh5 expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex gngt2a expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex rgra expression decreased amount, abnormal AB + MO4-tbx2b Fig. 6 from Khuansuwan et al., 2014
pineal complex morphology, abnormal zf104Tg + MO4-tbx2b Fig. 8 with image from Snelson et al., 2008
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
pronephric proximal convoluted tubule increased length, abnormal TU + MO4-tbx2b Fig. 3 with image from Drummond et al., 2017
Phenotype of all Fish created by or utilizing MO4-tbx2b
Phenotype Fish Conditions Figures
pineal complex otomp expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex gngt2a expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex rgra expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex rdh5 expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex otx5 expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pineal complex gngt1 expression decreased amount, abnormal AB + MO4-tbx2b standard conditions Fig. 6 from Khuansuwan et al., 2014
pronephric proximal convoluted tubule increased length, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius sim1a expression increased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric distal late tubule decreased length, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius cell increased amount, abnormal TU + MO4-tbx2b standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
corpuscles of Stannius stc1 expression increased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 4 with image from Drummond et al., 2017
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO4-tbx2b standard conditions Fig. 3 with image from Drummond et al., 2017
parapineal organ has fewer parts of type cell, abnormal WT + MO4-tbx2b standard conditions Fig. 7 with image from Clanton et al., 2013
parapineal organ has fewer parts of type parapineal organ neuron, abnormal sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
parapineal organ neuron fate specification decreased occurrence, abnormal sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
atrioventricular canal development disrupted, abnormal twu26Tg + MO4-tbx2b standard conditions Fig. 4 with image from Sedletcaia et al., 2011
heart looping disrupted, abnormal twu26Tg + MO4-tbx2b standard conditions Fig. 4 with image from Sedletcaia et al., 2011
epithalamus development disrupted, abnormal zf104Tg + MO4-tbx2b standard conditions Fig. 8 with image from Snelson et al., 2008
cell migration in diencephalon disrupted, abnormal zf104Tg + MO4-tbx2b standard conditions Fig. 8 with image from Snelson et al., 2008
pineal complex morphology, abnormal zf104Tg + MO4-tbx2b standard conditions Fig. 8 with image from Snelson et al., 2008
parapineal organ has fewer parts of type cell, abnormal fgf8ax15/x15 + MO4-tbx2b standard conditions Fig. 7 with image from Clanton et al., 2013
parapineal organ has number of parapineal organ neuron, ameliorated noton1/n1; sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
parapineal organ neuron fate specification occurrence, ameliorated noton1/n1; sqet11Et + MO4-tbx2b standard conditions Fig. 4 with image from Khuansuwan et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.