Morpholino

MO1-hsp70.3

ID

ZDB-MRPHLNO-050726-2

Name

MO1-hsp70.3

Previous Names

hsp70-MO2 (1)

Targets

hsp70.1 (1)
hsp70.3 (1)

Sequence

5' - ATGATTGATTTCAAGAAACTGCAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

View all 3 target locations

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hsp70.3

Expressed Gene	Anatomy	Figures
foxi1	non neural ectoderm	Fig 8 from Ye et al., 2019
otx2b	neuroectoderm	Fig 8 from Ye et al., 2019
szl	whole organism ventral region	Fig 7 , Fig 8 from Ye et al., 2019
ved	whole organism ventral region	Fig 8 from Ye et al., 2019

Phenotype

Phenotype resulting from MO1-hsp70.3

No data available

Phenotype of all Fish created by or utilizing MO1-hsp70.3

Phenotype	Fish	Conditions	Figures
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-hsp70.3	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	marcksb^{ihb199/ihb199} + MO1-hsp70.3	standard conditions	Fig 7 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	marcksb^{ihb199/ihb199} + MO1-hsp70.3	standard conditions	Fig 7 from Ye et al., 2019
whole organism ventral region szl expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism spindle-shaped, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region szl expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased amount, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
whole organism ventral region ved expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
non neural ectoderm foxi1 expression decreased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019
neuroectoderm otx2b expression increased distribution, abnormal	AB + MO1-hsp70.3 + MO1-marcksb	standard conditions	Fig 8 from Ye et al., 2019

Citations