Morpholino

MO1-fn1b

ID
ZDB-MRPHLNO-050620-3
Name
MO1-fn1b
Previous Names
  • MO1 fn3 (1)
Target
Sequence
5' - TACTGACTCACGGGTCATTTTCACC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fn1b
No data available
Phenotype
Phenotype resulting from MO1-fn1b
No data available
Phenotype of all Fish created by or utilizing MO1-fn1b
Phenotype Fish Conditions Figures
myotome myosin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image,  Fig. 3 with image,  Fig. 4 with image from Snow et al., 2008
myotome muscle tendon junction morphology, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image from Snow et al., 2008
somite shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament increased length, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image,  Fig. 3 with image from Snow et al., 2008
myotome variant shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image,  Fig. 2 with image from Snow et al., 2008
somite border aplastic, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
skeletal muscle fiber development disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image,  Fig. 3 with image from Snow et al., 2008
somitogenesis disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 4 with image from Snow et al., 2008
somite border shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image,  Fig. 2 with image from Snow et al., 2008
myotome increased size, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 6 with image from Rho et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 6 with image from Rho et al., 2019
somite border ab2-fn labeling absent, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
posterior lateral plate mesoderm cell morphology, abnormal ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
angioblast cell migration from lateral mesoderm to midline process quality, abnormal y1Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
posterior lateral plate mesoderm cell decreased adhesivity, abnormal hzm7Et; ncv2Tg + MO1-fn1a + MO1-fn1b control Fig. 5 with image from Rho et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.