Morpholino

MO2-wnt3a

ID
ZDB-MRPHLNO-050517-2
Name
MO2-wnt3a
Previous Names
  • MO2-wnt3l
  • MO3-wnt3a
  • wnt3aatgMO (1)
Target
Sequence
5' - GTTAGGCTTAAACTGACACGCACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt3a
Expressed Gene Anatomy Figures
dla Fig. 2 with image from Riley et al., 2004
irx1b Fig. 3 with image from Mattes et al., 2012
otx2b Fig. 3 with image from Mattes et al., 2012
shha Fig. 3 with image from Mattes et al., 2012
Phenotype
Phenotype resulting from MO2-wnt3a
No data available
Phenotype of all Fish created by or utilizing MO2-wnt3a
Phenotype Fish Conditions Figures
embryonic pattern specification disrupted, abnormal AB + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain disorganized, abnormal AB + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
thalamus development process quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
brain malformed, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 3 with image from Mattes et al., 2012
otic vesicle decreased size, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 3 with image from Mattes et al., 2012
mid diencephalic organizer decreased thickness, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
thalamus development decreased process quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image,  Fig. 6 with image from Mattes et al., 2012
ventral thalamus in contact with dorsal thalamus, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 6 with image from Mattes et al., 2012
midbrain hindbrain boundary cellular quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
mid diencephalic organizer cellular quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
post-vent region kinked, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 3 with image from Mattes et al., 2012
canonical Wnt signaling pathway decreased occurrence, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image,  Fig. 6 with image from Mattes et al., 2012
diencephalon lacks all parts of type mid diencephalic organizer, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 6 with image from Mattes et al., 2012
post-vent region decreased length, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
head increased size, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region has fewer parts of type somite, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region kinked, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
post-vent region truncated, abnormal WT + MO1-wnt8a + MO2-wnt3a + MO2-wnt8a standard conditions Fig. Table 1 from Shimizu et al., 2005
dorsal thalamus cellular quality, abnormal lhx2btv42z/tv42z + MO1-lhx9 + MO2-wnt3a standard conditions Fig. 5 with image from Peukert et al., 2011
thalamus development decreased process quality, abnormal lhx2btv42z/tv42z + MO1-lhx9 + MO2-wnt3a standard conditions Fig. 5 with image from Peukert et al., 2011
mid diencephalic organizer increased thickness, abnormal WT + MO1-fezf2 + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
ventral thalamus decreased thickness, abnormal WT + MO1-fezf2 + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
thalamus development process quality, abnormal WT + MO1-fezf2 + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
mid diencephalic organizer increased thickness, abnormal WT + MO1-irx1b + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
dorsal thalamus decreased thickness, abnormal WT + MO1-irx1b + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
thalamus development process quality, abnormal WT + MO1-irx1b + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
midbrain apoptotic, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 6 with image from Buckles et al., 2004
upper rhombic lip aplastic, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 5 with image from Buckles et al., 2004
cell proliferation in hindbrain decreased occurrence, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 6 with image from Buckles et al., 2004
embryonic pattern specification disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 2 with image from Riley et al., 2004
midbrain hindbrain boundary aplastic, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 3 with image from Buckles et al., 2004
cerebellum apoptotic, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 6 with image from Buckles et al., 2004
hindbrain morphology, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 2 with image from Riley et al., 2004
brain apoptotic, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a standard conditions Fig. 6 with image from Buckles et al., 2004
radial glial cell cell projection irregular spatial pattern, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
embryonic pattern specification disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
rhombomere primary neuron crowded, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
radial glial cell cell projection tangled, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
axon guidance disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain disorganized, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain commissure neuron absent, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
mid diencephalic organizer apoptotic, abnormal ka300Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 7 with image from Mattes et al., 2012
mid diencephalic organizer decreased size, abnormal ka300Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 7 with image from Mattes et al., 2012
canonical Wnt signaling pathway decreased occurrence, abnormal ka300Tg; vu17Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
mid diencephalic organizer cellular quality, abnormal ka300Tg; vu17Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
thalamus development decreased process quality, abnormal ka300Tg; vu17Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.