Morpholino

MO1-cdx1a

ID
ZDB-MRPHLNO-050509-3
Name
MO1-cdx1a
Previous Names
None
Target
Sequence
5' - GTCCAGCAGGTAGCTCACGGACATT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdx1a
Expressed Gene Anatomy Figures
aldh1a2 Fig. 5 with image,  Fig. S1 with image from Shimizu et al., 2006
cyp26a1 Fig. 5 with image,  Fig. S1 with image from Shimizu et al., 2006
egr2b Fig. 1 with image from Skromne et al., 2007
Fig. 2 with image from Shimizu et al., 2006
fgf3 Fig. 5 with image from Shimizu et al., 2006
fgf8a Fig. 5 with image,  Fig. S1 with image from Shimizu et al., 2006
ins Fig. 5 with image from Kinkel et al., 2008
isl1a Fig. 1 with image from Skromne et al., 2007
olig2 Fig. 1 with image from Skromne et al., 2007
pdx1 Fig. 5 with image from Kinkel et al., 2008
Phenotype
Phenotype resulting from MO1-cdx1a
No data available
Phenotype of all Fish created by or utilizing MO1-cdx1a
Phenotype Fish Conditions Figures
pancreatic bud increased size, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreatic B cell increased amount, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 4 with image from Kinkel et al., 2008
cell migration delayed, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreatic bud mislocalised posteriorly, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 5 with image from Kinkel et al., 2008
anterior/posterior pattern specification disrupted, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreas development disrupted, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreas primordium mislocalised posteriorly, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 5 with image from Kinkel et al., 2008
pancreas primordium increased size, abnormal cdx4hi2188aTg/+ + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
cell migration delayed, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
anterior/posterior pattern specification disrupted, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreatic B cell increased amount, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 4 with image from Kinkel et al., 2008
pancreatic bud increased size, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreas development disrupted, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreas primordium increased size, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 4 with image,  Fig. 5 with image from Kinkel et al., 2008
pancreas primordium mislocalised posteriorly, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 5 with image from Kinkel et al., 2008
pancreatic bud mislocalised posteriorly, abnormal cdx4hi2188aTg/hi2188aTg + MO1-cdx1a standard conditions Fig. 5 with image from Kinkel et al., 2008
rhombomere 7 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
post-vent region truncated, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 6 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
post-vent region decreased size, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
rhombomere 7 decreased size, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
presumptive blood absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. S4 with image from Skromne et al., 2007
post-vent region aplastic, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 3 with image from Shimizu et al., 2006
Fig. Table 2 from Shimizu et al., 2005
spinal cord decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain increased length, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
post-vent region has fewer parts of type somite, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. Table 2 from Shimizu et al., 2005
hindbrain-spinal cord boundary formation disrupted, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 2 with image from Skromne et al., 2007
spinal cord decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 2 with image from Skromne et al., 2007
spinal cord motor neuron absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
rhombomere increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
spinal cord oligodendrocyte absent, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
rhombomere 5 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
rhombomere 8 aplastic, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain increased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 2 with image from Skromne et al., 2007
rhombomere 4 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
hindbrain neuron mislocalised posteriorly, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 3 with image from Shimizu et al., 2006
whole organism decreased length, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image,  Fig. 3 with image from Shimizu et al., 2006
rhombomere 6 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 5 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 chemical treatment: BMS-493 Fig. 3 with image from Skromne et al., 2007
rhombomere 4 increased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 2 with image from Skromne et al., 2007
Rohon-Beard neuron decreased amount, abnormal WT + MO1-cdx1a + MO1-cdx4 standard conditions Fig. 1 with image from Skromne et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.