Morpholino

MO3-sox9b

ID
ZDB-MRPHLNO-050322-1
Name
MO3-sox9b
Previous Names
  • e2/i2-sox9b
Target
Sequence
5' - TGCAGTAATTTACCGGAGTGTTCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sox9b
No data available
Phenotype
Phenotype resulting from MO3-sox9b
Phenotype Fish Figures
atrioventricular valve formation decreased process quality, abnormal la116Tg + MO3-sox9b Fig. 8 from Hofsteen et al., 2013
heart elongated, abnormal WT + MO3-sox9b Fig. 6 from Hofsteen et al., 2013
heart lacks all parts of type ventricular epicardium cell, abnormal sqet27Et + MO3-sox9b Fig. 5 from Hofsteen et al., 2013
heart malformed, abnormal WT + MO3-sox9b Fig. 4,  Fig. 6 from Hofsteen et al., 2013
heart looping decreased process quality, abnormal WT + MO3-sox9b Fig. 6 from Hofsteen et al., 2013
pericardium edematous, abnormal WT + MO3-sox9b Fig. 4,  Fig. 6 from Hofsteen et al., 2013
proepicardial cluster absent, abnormal WT + MO3-sox9b Fig. 6 from Hofsteen et al., 2013
Phenotype of all Fish created by or utilizing MO3-sox9b
Phenotype Fish Conditions Figures
whole organism sox9b expression decreased amount, abnormal SPF 5-D + MO3-sox9b chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 1 from Garcia et al., 2018
whole organism si:ch1073-384e4.1 expression increased amount, abnormal SPF 5-D + MO3-sox9b chemical treatment by environment: 2,3,7,8-tetrachlorodibenzodioxine Fig. 1 from Garcia et al., 2018
pectoral fin endoskeletal disc decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
retroarticular aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
occipital arch cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
ceratobranchial cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
hyosymplectic cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
hyomandibula aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
parasphenoid decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
ethmoid cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
cleithrum decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
neurocranial trabecula decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
ceratobranchial 5 bone aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
maxilla aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
entopterygoid aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
iridophore decreased amount, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions text only from Yan et al., 2005
ceratohyal bone aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
palatoquadrate cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
basal plate cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
Meckel's cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
branchiostegal ray aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
opercle decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
post-vent region increased curvature, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
dentary aplastic, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 6 with image from Yan et al., 2005
melanocyte increased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions text only from Yan et al., 2005
fin fold actinotrichium decreased amount, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
ceratohyal cartilage decreased size, abnormal WT + MO2-sox9b + MO3-sox9b standard conditions Fig. 3 with image from Yan et al., 2005
heart malformed, abnormal WT + MO3-sox9b standard conditions Fig. 4,  Fig. 6 from Hofsteen et al., 2013
heart lacks all parts of type ventricular epicardium cell, abnormal WT + MO3-sox9b standard conditions Fig. 5 from Hofsteen et al., 2013
pericardium edematous, abnormal WT + MO3-sox9b standard conditions Fig. 4,  Fig. 6 from Hofsteen et al., 2013
heart elongated, abnormal WT + MO3-sox9b standard conditions Fig. 6 from Hofsteen et al., 2013
proepicardial cluster absent, abnormal WT + MO3-sox9b standard conditions Fig. 6 from Hofsteen et al., 2013
heart looping decreased process quality, abnormal WT + MO3-sox9b standard conditions Fig. 6 from Hofsteen et al., 2013
atrioventricular valve formation decreased process quality, abnormal la116Tg + MO3-sox9b standard conditions Fig. 8 from Hofsteen et al., 2013
heart lacks all parts of type ventricular epicardium cell, abnormal pd37Tg + MO3-sox9b standard conditions Fig. 5 from Hofsteen et al., 2013
heart lacks all parts of type ventricular epicardium cell, abnormal sqet27Et + MO3-sox9b standard conditions Fig. 5 from Hofsteen et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.