Morpholino

MO1-arrb2b

ID

ZDB-MRPHLNO-050124-2

Name

MO1-arrb2b

Previous Names

Target

Sequence

5' - AAGGGATGTTTCACAGAGACGAGAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-arrb2b

Expressed Gene	Anatomy	Figures
arrb2b	(not) whole organism	Fig. 1 from Wilbanks et al., 2004
bmp4	hypoblast	Fig. 2 from Yue et al., 2009
fli1	posterior lateral mesoderm	Fig. 2 from Yue et al., 2009
foxa2	floor plate	Fig. S3 from Wilbanks et al., 2004
lmo2	posterior lateral mesoderm	Fig. 2 from Yue et al., 2009
nkx2.2a	(not) brain (not) floor plate hindbrain	Fig. 5 from Evron et al., 2011 Fig. 3 from Wilbanks et al., 2004
nkx2.5	(not) lateral mesoderm	Fig. 2 from Yue et al., 2009
pax2a	midbrain hindbrain boundary optic stalk (not) otic vesicle	Fig. 5 from Evron et al., 2011
ptch2	lateral mesoderm (not) somite (not) spinal cord	Fig. 2 from Yue et al., 2009 Fig. 3 from Wilbanks et al., 2004
shha	floor plate neural tube floor plate spinal cord region	Fig. 3 from Wilbanks et al., 2004

Phenotype

Phenotype resulting from MO1-arrb2b

Phenotype	Fish	Figures
brain decreased size, abnormal	WT + MO1-arrb2b	Fig. S2 from Li et al., 2016
embryo development disrupted, abnormal	WT + MO1-arrb2b	Fig. 5 from Evron et al., 2011
muscle pioneer decreased amount, abnormal	WT + MO1-arrb2b	Fig. 6 from Evron et al., 2011
slow muscle cell decreased amount, abnormal	WT + MO1-arrb2b	Fig. 6 from Evron et al., 2011
somite atrophied, abnormal	WT + MO1-arrb2b	Fig. S2 from Li et al., 2016
somite disorganized, abnormal	WT + MO1-arrb2b	Fig. 5 from Evron et al., 2011
trunk curved, abnormal	WT + MO1-arrb2b	Fig. 5 from Evron et al., 2011

Phenotype of all Fish created by or utilizing MO1-arrb2b

Phenotype	Fish	Conditions	Figures
muscle pioneer decreased amount, abnormal	WT + MO1-arrb2b	standard conditions	Fig. 6 from Evron et al., 2011
somite disorganized, abnormal	WT + MO1-arrb2b	standard conditions	Fig. 5 from Evron et al., 2011
somite atrophied, abnormal	WT + MO1-arrb2b	standard conditions	Fig. S2 from Li et al., 2016
embryo development disrupted, abnormal	WT + MO1-arrb2b	standard conditions	Fig. 5 from Evron et al., 2011
trunk curved, abnormal	WT + MO1-arrb2b	standard conditions	Fig. 5 from Evron et al., 2011
brain decreased size, abnormal	WT + MO1-arrb2b	standard conditions	Fig. S2 from Li et al., 2016
slow muscle cell decreased amount, abnormal	WT + MO1-arrb2b	standard conditions	Fig. 6 from Evron et al., 2011

Citations