Morpholino

MO1-ihhb

ID
ZDB-MRPHLNO-041129-3
Name
MO1-ihhb
Previous Names
  • ehh-MO (1)
  • ehh-MO-1
  • MO1-ehh (1)
Target
Sequence
5' - GAGGAGCGCCGCCGCCGTGGAGAGTCTCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino targeting ehh.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ihhb
Expressed Gene Anatomy Figures
alcama Fig. 2 from Chung et al., 2013
ccne1 Fig. 3 from Chung et al., 2013
cdk2 Fig. 3 from Chung et al., 2013
cdkn1ca Fig. 3 from Chung et al., 2013
neurog1 Fig. 3 from Chung et al., 2013
olig2 Fig. 2 from Chung et al., 2013
sox10 Fig. 2,  Fig. 4 from Chung et al., 2013
Phenotype
Phenotype resulting from MO1-ihhb
Phenotype Fish Figures
glioblast (sensu Vertebrata) cell division increased occurrence, abnormal vu12Tg + MO1-ihhb Fig. 3 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal vu12Tg + MO1-ihhb Fig. 2,  Fig. 4 from Chung et al., 2013
spinal cord neuron increased amount, abnormal WT + MO1-ihhb Fig. 3 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal ck1Tg + MO1-ihhb Fig. 2 from Chung et al., 2013
spinal cord regulation of oligodendrocyte progenitor proliferation disrupted, abnormal WT + MO1-ihhb Fig. 4 from Chung et al., 2013
spinal cord spinal cord oligodendrocyte cell fate specification disrupted, abnormal vu12Tg + MO1-ihhb Fig. 2 from Chung et al., 2013
Phenotype of all Fish created by or utilizing MO1-ihhb
Phenotype Fish Conditions Figures
spinal cord regulation of oligodendrocyte progenitor proliferation disrupted, abnormal WT + MO1-ihhb standard conditions Fig. 4 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal WT + MO1-ihhb standard conditions Fig. 4 from Chung et al., 2013
spinal cord neuron increased amount, abnormal WT + MO1-ihhb standard conditions Fig. 3 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal ck1Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
glioblast (sensu Vertebrata) cell division increased occurrence, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 3 from Chung et al., 2013
spinal cord spinal cord oligodendrocyte cell fate specification disrupted, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
spinal cord oligodendrocyte decreased amount, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
spinal cord glioblast (sensu Vertebrata) decreased amount, abnormal vu12Tg + MO1-ihhb standard conditions Fig. 2 from Chung et al., 2013
primary motor neuron decreased amount, abnormal Df(Chr07)t4/t4 + MO1-ihhb + MO1-shhb (AB) standard conditions Fig. 2 with image from Lewis et al., 2001
positive regulation of DNA-templated transcription disrupted, abnormal Df(Chr07)t4/t4 + MO1-ihhb + MO2-shhb standard conditions Fig. 6 with image from Cheesman et al., 2004
positive regulation of DNA-templated transcription arrested, abnormal smob641/b641 + MO1-ihhb + MO2-shhb (AB) standard conditions Fig. 6 with image from Cheesman et al., 2004
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.