miRNA Gene
dre-mir-375-1
- ID
- ZDB-MIRNAG-071107-1
- Name
- microRNA 375-1
- Symbol
- dre-mir-375-1 Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 6 Mapping Details/Browsers
- Description
- Involved in endocrine pancreas development. Is expressed in endocrine pancreas; hypophysis; and pancreatic bud.
- Genome Resources
- Note
-
This is the precursor, stem-loom miRNA. When processed, the mature functional miRNA is mirn375 (miR-375) with sequence UUUGUUCGUUCGGCUCGCGUUA .
- Comparative Information
- All Expression Data
- 3 figures from Kloosterman et al., 2007
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- 1 Figure from Kloosterman et al., 2007
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
---|---|---|---|---|---|
mRNA |
dre-mir-375-1-201
(1)
|
Ensembl | 80 nt | ||
miRNA | mir375-001 (1) | 22 nt |
Interactions and Pathways
No data available
Plasmids
No data available