FIGURE

Fig. S1

ID

ZDB-FIG-161103-13

Publication

Sicca et al., 2016 - Gain-of-function defects of astrocytic Kir4.1 channels in children with autism spectrum disorders and epilepsy

Other Figures

All Figure Page

Back to All Figure Page

Fig. S1

WT and mutated Kir4.1 expression and distribution in U251 astrocytoma cells. (a) Immunofluorescence stainings of U251 astrocytoma cells with anti-Kir4.1 pAb (red) and FITC-conjugated phallacidin (green) to stain actin filaments show that the endogenous Kir4.1 channels are mainly distributed in cytoplasmic perinuclear area and scarcely at plasma membrane. Scale bars: 10 µm. (b) RT-PCR analysis using primers to detect specifically recombinant Kir4.1 mRNA expression (Forward: Xpress epitope/pcDNA 3.1/His, Life technologies; Kir4.1 Reverse: TCAGACATTGCTGATGCGCAC) in stably infected U251 cells reveals no differences between WT (1) and R18Q Kir4.1 (2) expressing cells. GAPDH housekeeping gene normalizes the amount of template used.

Expression Data

Expression Detail

Antibody Labeling

Phenotype Data

Phenotype Detail

Acknowledgments

This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ Sci. Rep.