CRISPR

CRISPR1-samd7

ID

ZDB-CRISPR-250402-3

Name

CRISPR1-samd7

Previous Names

None

Target

samd7 (1)

Sequence

5' - GGGAAGCAGAGTTGCGGCAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The second "G" was added. There is also a "G" at rs506481923.

Genome Resources

None

Target Location

View all 3 target locations

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
stl888	samd7

Expression

Gene expression in Wild Types + CRISPR1-samd7

No data available

Phenotype

Phenotype resulting from CRISPR1-samd7

No data available

Phenotype of all Fish created by or utilizing CRISPR1-samd7

Phenotype	Fish	Conditions	Figures
UV sensitive photoreceptor cell GFP expression increased amount, abnormal	samd7^{stl888/stl888}; kj9Tg/kj9Tg; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
red sensitive photoreceptor cell GFP expression increased amount, abnormal	samd7^{stl888/stl888}; kj9Tg/kj9Tg; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
photoreceptor cell eye photoreceptor cell differentiation decreased process quality, abnormal	samd7^{stl888/stl888}; kj9Tg/kj9Tg; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
red sensitive photoreceptor cell samd7 expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell Ab3-opn1sw1 labeling increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
green sensitive photoreceptor cell arr3a expression decreased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell tgfa expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell opn1lw1 expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
red sensitive photoreceptor cell opn1lw2 expression decreased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
red sensitive photoreceptor cell Ab3-opn1sw1 labeling increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
blue sensitive photoreceptor cell tbx2b expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell exorh expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
red sensitive photoreceptor cell arr3a expression decreased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell tbx2b expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell opn1sw1 expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell tbx2a expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
red sensitive photoreceptor cell dio3b expression decreased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell mir729 expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell arr3b expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
blue sensitive photoreceptor cell arr3b expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
UV sensitive photoreceptor cell grk7b expression increased amount, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024
photoreceptor cell eye photoreceptor cell differentiation decreased process quality, abnormal	samd7^{stl888/stl888}; q22Tg/q22Tg	standard conditions	Fig. 4 from Volkov et al., 2024

Citations