CRISPR

CRISPR6-npc1

ID
ZDB-CRISPR-250312-4
Name
CRISPR6-npc1
Previous Names
None
Target
Sequence
5' - GTATCTGGTACGGCGAATGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR6-npc1
No data available
Phenotype
Phenotype resulting from CRISPR6-npc1
No data available
Phenotype of all Fish created by or utilizing CRISPR6-npc1
Phenotype Fish Conditions Figures
hindbrain microglial cell mCherry expression spatial pattern, abnormal zh901Tg/zh901Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: camptothecin Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal zh901Tg/zh901Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal zh901Tg/zh901Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal zh901Tg/zh901Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
hindbrain glial cell projection decreased amount, exacerbated zh901Tg/zh901Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: camptothecin Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell vacuolated, ameliorated i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: camptothecin Fig. 6 with image from Zareba et al., 2024
optic tectum microglial cell circular, ameliorated i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: HYDROXYPROPYL BETADEX Fig. 6 with image from Zareba et al., 2024
optic tectum phagocytic vesicle increased size, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 2 with imageFig. 3 with image from Zareba et al., 2024
hindbrain glial cell projection decreased amount, exacerbated i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: camptothecin Fig. 1 with image from Zareba et al., 2024
hindbrain microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: camptothecin Fig. 1 with image from Zareba et al., 2024
microglial cell cholesterol storage increased occurrence, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 3 with image from Zareba et al., 2024
optic tectum microglial cell vacuolated, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 2 with imageFig. 3 with imageFig. 6 with image from Zareba et al., 2024
optic tectum microglial cell circular, ameliorated i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: camptothecin Fig. 6 with image from Zareba et al., 2024
optic tectum microglial cell vacuolated, ameliorated i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 chemical treatment by environment: HYDROXYPROPYL BETADEX Fig. 6 with image from Zareba et al., 2024
microglial cell ganglioside galactosyltransferase activity increased occurrence, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 3 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with imageFig. 6 with image from Zareba et al., 2024
hindbrain microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 2 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum phagocytic vesicle ballooning, abnormal slc37a2t30301/t30301; i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 3 with image from Zareba et al., 2024
microglial cell ganglioside galactosyltransferase activity increased occurrence, abnormal slc37a2t30301/t30301; i149Tg/i149Tg; i186Tg/i186Tg + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 3 with image from Zareba et al., 2024
Citations