CRISPR

CRISPR4-nr2f1a

ID

ZDB-CRISPR-241031-3

Name

CRISPR4-nr2f1a

Previous Names

None

Target

nr2f1a (1)

Sequence

5' - ATGTATATGTTAAGTTCCTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "CGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sud21	nr2f1a

Expression

Gene expression in Wild Types + CRISPR4-nr2f1a

No data available

Phenotype

Phenotype resulting from CRISPR4-nr2f1a

No data available

Phenotype of all Fish created by or utilizing CRISPR4-nr2f1a

Phenotype	Fish	Conditions	Figures
telencephalon anterior side vax2 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
heart edematous, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 3 from Chowdhury et al., 2024
preoptic area vax2 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
optic cup vax2 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
eye pax6a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
optic stalk vax2 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
telencephalon anterior side fgf8a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
zona limitans intrathalamica shha expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
diencephalon dorsal side fgf8a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
optic stalk pax2a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
hypothalamus vax1 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
preoptic area vax1 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
telencephalon decreased size, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 3 from Chowdhury et al., 2024
optic cup ventral side vax1 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
preoptic area shha expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
hindbrain apoptotic process increased frequency, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 5 from Chowdhury et al., 2024
ventral telencephalon dlx2a expression increased distribution, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
optic tectum apoptotic process increased frequency, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 5 from Chowdhury et al., 2024
hypothalamus shha expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
hypothalamus vax2 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
dorsal telencephalon antero-ventral region emx3 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
eye decreased size, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 3 , Fig. 4 from Chowdhury et al., 2024
midbrain apoptotic process increased frequency, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 5 from Chowdhury et al., 2024
telencephalon anterior side six3b expression increased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
telencephalon decreased thickness, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 3 from Chowdhury et al., 2024
preoptic area nkx2.1 expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
brain decreased size, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 4 from Chowdhury et al., 2024
telencephalon pax6a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
midbrain hindbrain boundary fgf8a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
diencephalon pax6a expression decreased amount, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024
telencephalon apoptotic process increased frequency, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 5 from Chowdhury et al., 2024
eye apoptotic process increased frequency, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 5 from Chowdhury et al., 2024
whole organism dead, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 3 from Chowdhury et al., 2024
ventral thalamus dlx2a expression increased distribution, abnormal	nr2f1a^sud21/sud21	standard conditions	Fig. 6 from Chowdhury et al., 2024

Citations