CRISPR

CRISPR5-znf536

ID
ZDB-CRISPR-241031-2
Name
CRISPR5-znf536
Previous Names
None
Target
Sequence
5' - GGAAATCTTGGTAAGGGCCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ck109a znf536
Expression
Gene expression in Wild Types + CRISPR5-znf536
No data available
Phenotype
Phenotype resulting from CRISPR5-znf536
No data available
Phenotype of all Fish created by or utilizing CRISPR5-znf536
Phenotype Fish Conditions Figures
telencephalon fosab expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. 6 with image from Kim et al., 2024
cerebellum Bergmann glial cell decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S8 from Kim et al., 2024
behavioral fear response decreased process quality, abnormal znf536ck109a/ck109a control Fig. 3 with image from Kim et al., 2024
valvula cerebelli ab1-pvalb7 labeling decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S7 from Kim et al., 2024
social behavior decreased process quality, abnormal znf536ck109a/ck109a control Fig. 4 with image from Kim et al., 2024
valvula cerebelli aldoca expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. 6 with image from Kim et al., 2024
Purkinje cell layer valvula cerebelli Purkinje cell decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. 6 with image from Kim et al., 2024
cerebellum GABAergic neuron decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S8 from Kim et al., 2024
eating behavior decreased process quality, abnormal znf536ck109a/ck109a control Fig. 2 with image from Kim et al., 2024
valvula cerebelli ca8 expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. 6 with image from Kim et al., 2024
valvula cerebelli znp-1 labeling decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S7 from Kim et al., 2024
cerebellum fosab expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. 6 with image from Kim et al., 2024
cerebellum gad1b expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S8 from Kim et al., 2024
valvula cerebelli pvalb7 expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. 6 with image from Kim et al., 2024
whole organism decreased size, abnormal znf536ck109a/ck109a standard conditions Fig. 1 with image from Kim et al., 2024
whole organism viability, abnormal znf536ck109a/ck109a standard conditions Fig. 1 with image from Kim et al., 2024
valvula cerebelli ab1-pan-maguk labeling decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S7 from Kim et al., 2024
valvula cerebelli decreased area, abnormal znf536ck109a/ck109a control Fig. 5 with image from Kim et al., 2024
cerebellum decreased size, abnormal znf536ck109a/ck109a control Fig. 5 with image from Kim et al., 2024
brain znf536 expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S3 from Kim et al., 2024
cerebellum grik6 expression decreased distribution, abnormal znf536ck109a/ck109a standard conditions Fig. S8 from Kim et al., 2024
valvula cerebelli myelin sheath EGFP expression decreased distribution, abnormal znf536ck109a/ck109a; ck1Tg standard conditions Fig. 6 with image from Kim et al., 2024
valvula cerebelli myelin sheath EGFP expression spatial pattern, abnormal znf536ck109a/ck109a; ck1Tg standard conditions Fig. 6 with image from Kim et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.