CRISPR

CRISPR1-ipo8

ID

ZDB-CRISPR-241011-2

Name

CRISPR1-ipo8

Previous Names

None

Target

ipo8 (1)

Sequence

5' - AGTCGCAGAACAGTGGCAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
idv8	ipo8

Expression

Gene expression in Wild Types + CRISPR1-ipo8

No data available

Phenotype

Phenotype resulting from CRISPR1-ipo8

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ipo8

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 3 from Ziegler et al., 2021
blastomere loose, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
post-vent region blood vasculature irregular spatial pattern, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
somite myod1 expression spatial pattern, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
whole organism viability, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
caudal fin ventral side absence of anatomical entity, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 3 from Ziegler et al., 2021
lateral plate mesoderm gata1a expression decreased distribution, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
whole organism ovate, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 3 from Ziegler et al., 2021
trabecula cranii sox9a expression decreased distribution, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
paraxial mesoderm myod1 expression spatial pattern, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
post-vent region deformed, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 3 from Ziegler et al., 2021
blastomere ipo8 expression absent, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
dorsal/ventral pattern formation decreased process quality, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
cartilage development decreased process quality, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
blastomere cell detached from blastomere, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
neurocranium sox9a expression decreased distribution, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
early embryonic cell BMP signaling pathway decreased process quality, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 5 from Ziegler et al., 2021
axial chorda mesoderm tbxta expression decreased distribution, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
whole organism ipo8 expression decreased amount, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
post-vent region blood circulation decreased process quality, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
whole organism dorsalized, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 3 from Ziegler et al., 2021
notochord sox9a expression spatial pattern, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. S4 from Ziegler et al., 2021
early embryonic cell cytoplasm Ab13-smad labeling mislocalised, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 5 from Ziegler et al., 2021
whole organism dorsal/ventral pattern formation decreased process quality, abnormal	ipo8^idv8/idv8 (TU)	standard conditions	Fig. 5 from Ziegler et al., 2021
whole organism viability, abnormal	ipo8^idv8/+ (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
blastomere ipo8 expression absent, abnormal	ipo8^idv8/+ (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
whole organism ipo8 expression decreased amount, abnormal	ipo8^idv8/+ (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
whole organism ipo8 expression decreased amount, abnormal	ipo8^idv8/+ (TU)	standard conditions	Figure 6. from Mbarek et al., 2023
central artery irregular spatial pattern, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
central artery morphology, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
heart morphology, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
heart cardiac chamber formation decreased process quality, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
head blood vasculature morphology, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
central artery lumen decreased size, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021
central artery decreased thickness, abnormal	ipo8^idv8/idv8; s916Tg (TU)	standard conditions	Fig. 4 from Ziegler et al., 2021

Citations