CRISPR

CRISPR1-cygb2

ID

ZDB-CRISPR-241002-10

Name

CRISPR1-cygb2

Previous Names

None

Target

cygb2 (1)

Sequence

5' - GGTGGAGCGGGGCATCATTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first "G" was added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
pt801a	cygb2

Expression

Gene expression in Wild Types + CRISPR1-cygb2

No data available

Phenotype

Phenotype resulting from CRISPR1-cygb2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cygb2

Phenotype	Fish	Conditions	Figures
whole organism 3',5'-cyclic GMP decreased amount, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 3 from Rochon et al., 2023
whole organism nos2b expression decreased amount, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 3 from Rochon et al., 2023
heart determination of heart left/right asymmetry process quality, ameliorated	cygb2^{pt801a/pt801a} (AB)	chemical treatment by environment: diethylamine NONOate	Fig. 4 from Rochon et al., 2023
heart tube embryonic heart tube left/right pattern formation decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 1 from Rochon et al., 2023
lateral plate mesoderm determination of left/right asymmetry in lateral mesoderm decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 1 from Rochon et al., 2023
liver determination of liver left/right asymmetry decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 1 from Rochon et al., 2023
Kupffer's vesicle lumen decreased fluid flow, abnormal	cygb2^{pt801a/pt801a} (AB)	control	Fig. 4 from Rochon et al., 2023
whole organism 3',5'-cyclic GMP increased amount, abnormal	cygb2^{pt801a/pt801a} (AB)	chemical treatment by environment: diethylamine NONOate	Fig. 3 from Rochon et al., 2023
Kupffer's vesicle cilium assembly decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 2 from Rochon et al., 2023
heart determination of heart left/right asymmetry process quality, ameliorated	cygb2^{pt801a/pt801a} (AB)	chemical treatment by environment: cinaciguat	Fig. 4 from Rochon et al., 2023
pancreas determination of pancreatic left/right asymmetry decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 1 from Rochon et al., 2023
positive regulation of nitric oxide biosynthetic process decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 2 from Rochon et al., 2023
lateral plate mesoderm right side spaw expression mislocalised, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 1 from Rochon et al., 2023
whole organism nitric oxide decreased amount, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 2 from Rochon et al., 2023
Kupffer's vesicle motile cilium has fewer parts of type Kupffer's vesicle axonemal central pair, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 2 from Rochon et al., 2023
Kupffer's vesicle motile cilium decreased length, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 2 from Rochon et al., 2023
heart determination of heart left/right asymmetry decreased process quality, abnormal	cygb2^{pt801a/pt801a} (AB)	standard conditions	Fig. 1 , Fig. 4 from Rochon et al., 2023
Kupffer's vesicle lumen fluid flow rate, ameliorated	cygb2^{pt801a/pt801a} (AB)	chemical treatment by environment: diethylamine NONOate	Fig. 4 from Rochon et al., 2023
heart determination of heart left/right asymmetry decreased process quality, abnormal	cygb2^{pt801a/pt801a}; y1Tg	standard conditions	Fig. 1 from Rochon et al., 2023

Citations