CRISPR

CRISPR1-six2b

ID
ZDB-CRISPR-240913-1
Name
CRISPR1-six2b
Previous Names
None
Target
Sequence
5' - GCAGTAGTAGCTTTCCACCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bhs1 six2b
Expression
Gene expression in Wild Types + CRISPR1-six2b
No data available
Phenotype
Phenotype resulting from CRISPR1-six2b
Phenotype of all Fish created by or utilizing CRISPR1-six2b
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule cdh17 expression spatial pattern, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
whole organism six2b expression increased amount, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
whole organism six2a expression increased amount, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
whole organism six2b expression decreased amount, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
whole organism six2a expression increased amount, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression decreased distribution, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal six2bbhs1/bhs1 (AB) standard conditions Figure 3 with image from Belcher et al., 2023
pronephric glomerulus nphs2 expression increased distribution, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric glomerulus wt1a expression increased distribution, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric glomerulus nphs1 expression spatial pattern, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric glomerulus nphs2 expression spatial pattern, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric tubule pax2a expression spatial pattern, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric glomerulus nphs1 expression increased distribution, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
pronephric glomerulus wt1a expression spatial pattern, abnormal AB + CRISPR1-six2b control Figure 4 with image from Belcher et al., 2023
Citations