CRISPR

CRISPR1-six2b

ID

ZDB-CRISPR-240913-1

Name

CRISPR1-six2b

Previous Names

None

Target

six2b (1)

Sequence

5' - GCAGTAGTAGCTTTCCACCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
bhs1	six2b

Expression

Gene expression in Wild Types + CRISPR1-six2b

Expressed Gene	Anatomy	Figures
cdh17	pronephric proximal convoluted tubule pronephric tubule epithelium	Figure 4 from Belcher et al., 2023
nphs1	pronephric glomerulus	Figure 4 from Belcher et al., 2023
nphs2	pronephric glomerulus	Figure 4 from Belcher et al., 2023
pax2a	pronephric tubule	Figure 4 from Belcher et al., 2023
slc20a1a	pronephric proximal convoluted tubule	Figure 4 from Belcher et al., 2023
trpm7	pronephric proximal straight tubule	Figure 4 from Belcher et al., 2023
wt1a	pronephric glomerulus	Figure 4 from Belcher et al., 2023

Phenotype

Phenotype resulting from CRISPR1-six2b

Phenotype	Fish	Figures
pronephric glomerulus wt1a expression increased distribution, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs2 expression increased distribution, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs1 expression increased distribution, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs1 expression spatial pattern, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric glomerulus wt1a expression spatial pattern, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs2 expression spatial pattern, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023
pronephric tubule pax2a expression spatial pattern, abnormal	AB + CRISPR1-six2b	Figure 4 from Belcher et al., 2023

Phenotype of all Fish created by or utilizing CRISPR1-six2b

Phenotype	Fish	Conditions	Figures
pronephric proximal convoluted tubule cdh17 expression spatial pattern, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
whole organism six2b expression increased amount, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
whole organism six2a expression increased amount, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
whole organism six2b expression decreased amount, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
whole organism six2a expression increased amount, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression decreased distribution, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal	six2b^bhs1/bhs1 (AB)	standard conditions	Figure 3 from Belcher et al., 2023
pronephric glomerulus nphs2 expression increased distribution, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric glomerulus wt1a expression increased distribution, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs1 expression spatial pattern, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs2 expression spatial pattern, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric proximal convoluted tubule slc20a1a expression spatial pattern, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric proximal convoluted tubule cdh17 expression decreased distribution, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric tubule pax2a expression spatial pattern, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric glomerulus nphs1 expression increased distribution, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023
pronephric glomerulus wt1a expression spatial pattern, abnormal	AB + CRISPR1-six2b	control	Figure 4 from Belcher et al., 2023

Citations