CRISPR

CRISPR2-rptor

ID
ZDB-CRISPR-240808-2
Name
CRISPR2-rptor
Previous Names
None
Target
Sequence
5' - GGCAGAGGCATCTGAGCTAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
au93 rptor
Expression
Gene expression in Wild Types + CRISPR2-rptor
No data available
Phenotype
Phenotype resulting from CRISPR2-rptor
No data available
Phenotype of all Fish created by or utilizing CRISPR2-rptor
Phenotype Fish Conditions Figures
ceratohyal cartilage decreased length, abnormal rptorau93/au93 (AB) chemical treatment by environment: chloroquine Fig. 10 with image from Tucker et al., 2024
ethmoid cartilage length, ameliorated rptorau93/au93 (AB) chemical treatment by environment: chloroquine Fig. 10 with image from Tucker et al., 2024
neurocranium decreased length, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
ethmoid cartilage decreased length, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
Meckel's cartilage length, ameliorated rptorau93/au93 (AB) chemical treatment by environment: chloroquine Fig. 10 with image from Tucker et al., 2024
trabecula cranii chondrocyte decreased area, abnormal rptorau93/au93 (AB) standard conditions Fig. 5 with image from Tucker et al., 2024
eye decreased width, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
ethmoid cartilage decreased width, abnormal rptorau93/au93 (AB) chemical treatment by environment: chloroquine Fig. 10 with image from Tucker et al., 2024
trabecula cranii decreased length, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
autophagy increased occurrence, abnormal rptorau93/au93 (AB) standard conditions Fig. 9 with image from Tucker et al., 2024
trabecula cranii chondrocyte decreased amount, abnormal rptorau93/au93 (AB) standard conditions Fig. 5 with image from Tucker et al., 2024
eye decreased width, abnormal rptorau93/au93 (AB) chemical treatment by environment: chloroquine Fig. 10 with image from Tucker et al., 2024
neurocranium length, ameliorated rptorau93/au93 (AB) chemical treatment by environment: chloroquine Fig. 10 with image from Tucker et al., 2024
Meckel's cartilage decreased length, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 7 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
whole organism rptor expression decreased amount, abnormal rptorau93/au93 (AB) standard conditions Fig. 2 with image from Tucker et al., 2024
ceratohyal cartilage decreased length, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
whole organism viability, abnormal rptorau93/au93 (AB) chemical treatment by environment: chloroquine text only from Tucker et al., 2024
ethmoid cartilage decreased width, abnormal rptorau93/au93 (AB) control Fig. 4 with imageFig. 10 with imageFig. 11 with image from Tucker et al., 2024
Meckel's cartilage length, ameliorated rptorau93/au93 (AB) chemical treatment by environment: EC 3.4.22.56 (caspase-3) inhibitor Fig. 7 with image from Tucker et al., 2024
whole organism Ab6-map1lc3b labeling increased amount, abnormal rptorau93/au93 (AB) standard conditions Fig. 9 with image from Tucker et al., 2024
ceratobranchial cartilage decreased amount, abnormal rptorau93/au93 (AB) standard conditions Fig. 4 with image from Tucker et al., 2024
cranial neural crest cell death increased occurrence, abnormal rptorau93/au93; y1Tg (AB) standard conditions Fig. 6 with image from Tucker et al., 2024
cranial neural crest cell death occurrence, ameliorated rptorau93/au93; y1Tg (AB) chemical treatment by environment: chloroquine Fig. 12 with image from Tucker et al., 2024
Meckel's cartilage length, ameliorated atg7sa14768/sa14768; rptorau93/au93 (AB) standard conditions Fig. 11 with image from Tucker et al., 2024
trabecula cranii length, ameliorated atg7sa14768/sa14768; rptorau93/au93 (AB) standard conditions Fig. 11 with image from Tucker et al., 2024
ceratohyal cartilage decreased length, abnormal atg7sa14768/sa14768; rptorau93/au93 (AB) standard conditions Fig. 11 with image from Tucker et al., 2024
ethmoid cartilage width, ameliorated atg7sa14768/sa14768; rptorau93/au93 (AB) standard conditions Fig. 11 with image from Tucker et al., 2024
eye width, ameliorated atg7sa14768/sa14768; rptorau93/au93 (AB) standard conditions Fig. 11 with image from Tucker et al., 2024
ethmoid cartilage length, ameliorated atg7sa14768/sa14768; rptorau93/au93 (AB) standard conditions Fig. 11 with image from Tucker et al., 2024
pharyngeal arch autophagy increased occurrence, abnormal rptorau93/au93; zf155Tg (AB) standard conditions Fig. 8 with image from Tucker et al., 2024
Citations