CRISPR

CRISPR1-tspearb

ID
ZDB-CRISPR-240509-25
Name
CRISPR1-tspearb
Previous Names
None
Target
Sequence
5' - GGTGCAGGATGGTATACGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
omf107 tspearb
Expression
Gene expression in Wild Types + CRISPR1-tspearb
No data available
Phenotype
Phenotype resulting from CRISPR1-tspearb
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tspearb
Phenotype Fish Conditions Figures
anal fin lepidotrichium decreased branchiness, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S14 from Jackson et al., 2023
pelvic fin lepidotrichium decreased branchiness, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S14 from Jackson et al., 2023
whole organism fgf1b expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16Fig. S17 from Jackson et al., 2023
dorsal fin lepidotrichium decreased branchiness, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S14 from Jackson et al., 2023
ceratobranchial 5 tooth disorganized, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. 5 with image from Jackson et al., 2023
caudal fin fin regeneration decreased process quality, abnormal tspearbomf107/omf107; tspearaomf106/omf106 amputation: caudal fin Fig. 5 with image from Jackson et al., 2023
ceratobranchial 5 tooth decreased thickness, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. 5 with image from Jackson et al., 2023
whole organism sox8b expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16 from Jackson et al., 2023
whole organism ambn expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S17 from Jackson et al., 2023
precaudal vertebra increased width, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S14 from Jackson et al., 2023
whole organism mmp20b expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S17 from Jackson et al., 2023
whole organism kcnk5a expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16 from Jackson et al., 2023
whole organism mustn1a expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16 from Jackson et al., 2023
precaudal vertebra bifurcated, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S14 from Jackson et al., 2023
whole organism mmp20a expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S17 from Jackson et al., 2023
whole organism scpp5 expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16Fig. S17 from Jackson et al., 2023
ceratobranchial 5 tooth decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. 5 with image from Jackson et al., 2023
ceratobranchial 5 tooth bone mineralization decreased process quality, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. 5 with image from Jackson et al., 2023
whole organism scpp7 expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16 from Jackson et al., 2023
whole organism odam expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S17 from Jackson et al., 2023
whole organism cdkn1a expression increased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16 from Jackson et al., 2023
whole organism dlx2b expression increased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16 from Jackson et al., 2023
whole organism enam expression decreased amount, abnormal tspearbomf107/omf107; tspearaomf106/omf106 standard conditions Fig. S16Fig. S17 from Jackson et al., 2023
Citations