CRISPR

CRISPR1-shank2b

ID
ZDB-CRISPR-240410-5
Name
CRISPR1-shank2b
Previous Names
None
Target
Sequence
5' - GGATCGGAGCAGCACTCGCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3937 shank2b
Expression
Gene expression in Wild Types + CRISPR1-shank2b
No data available
Phenotype
Phenotype resulting from CRISPR1-shank2b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-shank2b
Phenotype Fish Conditions Figures
response to light stimulus disrupted, abnormal shank2bzf3937/zf3937 (TU) light intensity Figure 3 with image from Wang et al., 2023
brain gabrd expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
head decreased size, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S2 from Wang et al., 2023
swimming increased linear velocity, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 2 with image from Wang et al., 2023
swimming increased occurrence, abnormal shank2bzf3937/zf3937 (TU) light intensity Figure 3 with imageFigure 4 with image from Wang et al., 2023
brain gabra2a expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
brain gabrb4 expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
male organism heart shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
brain gabrb2a expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
whole organism decreased length, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S2 from Wang et al., 2023
male organism liver shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
brain gabra5 expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
male organism muscle shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
eye decreased distance eye, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S2 from Wang et al., 2023
brain gabra1 expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
startle response increased magnitude, abnormal shank2bzf3937/zf3937 (TU) light intensity Figure 3 with image from Wang et al., 2023
male organism spleen shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
swimming decreased occurrence, abnormal shank2bzf3937/zf3937 (TU) light intensity, chemical treatment by environment: pentetrazol Figure 4 with image from Wang et al., 2023
brain gabrg1 expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
thigmotaxis increased occurrence, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 2 with image from Wang et al., 2023
male organism integument shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
male organism brain shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 1 with image from Wang et al., 2023
male organism social behavior disrupted, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 2 with image from Wang et al., 2023
swimming behavior disrupted, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 2 with image from Wang et al., 2023
male organism gall bladder shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
ovary shank2b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Fig. S1 from Wang et al., 2023
brain gabra6b expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
brain gabra4 expression decreased amount, abnormal shank2bzf3937/zf3937 (TU) standard conditions Figure 4 with image from Wang et al., 2023
Citations