CRISPR

CRISPR1-ptpn6

ID

ZDB-CRISPR-240318-6

Name

CRISPR1-ptpn6

Previous Names

None

Target

ptpn6 (1)

Sequence

5' - GGAACCCTACAGGATAAAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hu12408	ptpn6

Expression

Gene expression in Wild Types + CRISPR1-ptpn6

No data available

Phenotype

Phenotype resulting from CRISPR1-ptpn6

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ptpn6

Phenotype	Fish	Conditions	Figures
integument ruffled, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
caudal hematopoietic tissue neutrophil decreased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 3. from Allers et al., 2023
whole organism mmp9 expression increased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
pharyngeal arch accumulation neutrophil, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
caudal hematopoietic tissue leukocyte lcp1 expression increased distribution, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 3. from Allers et al., 2023
head neutrophil decreased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 3. from Allers et al., 2023
integument neutrophil infiltrative, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
caudal hematopoietic tissue leukocyte increased distribution, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 3. from Allers et al., 2023
hematopoietic multipotent progenitor cell decreased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 5. from Allers et al., 2023
whole organism tnfa expression increased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
whole organism fkbp5 expression increased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
whole organism il1b expression increased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
whole organism ptpn6 expression absent, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 1. from Allers et al., 2023
whole organism viability, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
whole organism dead, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
caudal hematopoietic tissue macrophage csf1ra expression increased distribution, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 3. from Allers et al., 2023
hematopoietic stem cell decreased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 5. from Allers et al., 2023
whole organism acod1 expression increased amount, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
gill accumulation neutrophil, abnormal	ptpn6^{hu12408/hu12408} (TL)	standard conditions	Fig. 2. from Allers et al., 2023
caudal hematopoietic tissue neutrophil decreased amount, abnormal	ptpn6^hu12408/+ (TL)	standard conditions	Fig. 3. from Allers et al., 2023
head neutrophil decreased amount, abnormal	ptpn6^hu12408/+ (TL)	standard conditions	Fig. 3. from Allers et al., 2023
pharyngeal arch accumulation neutrophil, abnormal	ptpn6^hu12408/+; i114Tg (TL)	standard conditions	Fig. 2. from Allers et al., 2023
integument neutrophil infiltrative, abnormal	ptpn6^hu12408/+; i114Tg (TL)	standard conditions	Fig. 2. from Allers et al., 2023
gill accumulation neutrophil, abnormal	ptpn6^hu12408/+; i114Tg (TL)	standard conditions	Fig. 2. from Allers et al., 2023
caudal hematopoietic tissue neutrophil decreased amount, abnormal	ptpn6^{hu12408/hu12408}; gl23Tg; i114Tg (TL)	standard conditions	Fig. 4. from Allers et al., 2023
caudal fin macrophage migration decreased process quality, abnormal	ptpn6^{hu12408/hu12408}; gl23Tg; i114Tg (TL)	amputation: caudal fin	Fig. 6. from Allers et al., 2023
caudal hematopoietic tissue macrophage increased amount, abnormal	ptpn6^{hu12408/hu12408}; gl23Tg; i114Tg (TL)	standard conditions	Fig. 4. from Allers et al., 2023
caudal fin neutrophil migration decreased process quality, abnormal	ptpn6^{hu12408/hu12408}; gl23Tg; i114Tg (TL)	amputation: caudal fin	Fig. 6. from Allers et al., 2023
head macrophage increased amount, abnormal	ptpn6^{hu12408/hu12408}; gl23Tg; i114Tg (TL)	standard conditions	Fig. 4. from Allers et al., 2023
head neutrophil decreased amount, abnormal	ptpn6^{hu12408/hu12408}; gl23Tg; i114Tg (TL)	standard conditions	Fig. 4. from Allers et al., 2023
neutrophil decreased amount, abnormal	ptpn6^{hu12408/hu12408}; i114Tg (TL)	standard conditions	Fig. 4. from Allers et al., 2023
gill neutrophil GFP expression increased distribution, abnormal	ptpn6^{hu12408/hu12408}; i114Tg (TL)	standard conditions	Fig. 2. from Allers et al., 2023
pharyngeal arch neutrophil GFP expression increased distribution, abnormal	ptpn6^{hu12408/hu12408}; i114Tg (TL)	standard conditions	Fig. 2. from Allers et al., 2023
integument neutrophil GFP expression increased distribution, abnormal	ptpn6^{hu12408/hu12408}; i114Tg (TL)	standard conditions	Fig. 2. from Allers et al., 2023
hematopoietic multipotent progenitor cell increased amount, abnormal	ptpn6^{hu12408/hu12408}; la2Tg; s916Tg (TL)	standard conditions	Fig. 5. from Allers et al., 2023
caudal hematopoietic tissue ab4-h3 labeling increased distribution, abnormal	ptpn6^{hu12408/hu12408}; la2Tg; s916Tg (TL)	standard conditions	Fig. 5. from Allers et al., 2023
caudal hematopoietic tissue cell population proliferation increased process quality, abnormal	ptpn6^{hu12408/hu12408}; la2Tg; s916Tg (TL)	standard conditions	Fig. 5. from Allers et al., 2023
hematopoietic stem cell increased amount, abnormal	ptpn6^{hu12408/hu12408}; la2Tg; s916Tg (TL)	standard conditions	Fig. 5. from Allers et al., 2023

Citations