CRISPR

CRISPR2-il11ra

ID
ZDB-CRISPR-240123-1
Name
CRISPR2-il11ra
Previous Names
None
Target
Sequence
5' - ATGGTGGAGTTAGATCCCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns251 il11ra
Expression
Gene expression in Wild Types + CRISPR2-il11ra
No data available
Phenotype
Phenotype resulting from CRISPR2-il11ra
No data available
Phenotype of all Fish created by or utilizing CRISPR2-il11ra
Phenotype Fish Conditions Figures
cardiac ventricle cilp2 expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle tgfb2 expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle fn1b expression decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
regenerating fin fgf20a expression decreased amount, abnormal il11rabns251/bns251 amputation: caudal fin Fig. 3. with image from Allanki et al., 2021
cardiac ventricle il11ra expression decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
ventral fin fold fin regeneration decreased process quality, abnormal il11rabns251/bns251 amputation: ventral fin fold Fig. 2. with image from Allanki et al., 2021
cardiac ventricle acta2 expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
regenerating tissue cardiac muscle cell proliferation decreased occurrence, abnormal il11rabns251/bns251 ablation: heart Fig. 4. with image from Allanki et al., 2021
cardiac ventricle fgf20a expression decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
cardiac ventricle mylka expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
regenerating tissue retinol metabolic process decreased process quality, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
cardiac muscle cell substrate-dependent cell migration, cell extension decreased process quality, abnormal il11rabns251/bns251 ablation: heart Fig. 4. with image from Allanki et al., 2021
cardiac ventricle egr2b expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle loxa expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
regenerating tissue endocardium ab1-elna labeling increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle tgfb1a expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle regeneration fibroblast Ab7-acta2 labeling increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle ab2-fn labeling decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
cardiac ventricle proliferative region ab2-pcna labeling decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 4. with image from Allanki et al., 2021
cardiac ventricle socs3b expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle connective tissue replacement involved in inflammatory response wound healing increased occurrence, abnormal il11rabns251/bns251 ablation: heart Fig. 2. with image from Allanki et al., 2021
cardiac ventricle vcanb expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle extracellular matrix organization increased occurrence, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle socs3b expression decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
cardiac ventricle aldh1a2 expression decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
cardiac ventricle ab1-aldh1a2 labeling decreased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 3. with image from Allanki et al., 2021
cardiac ventricle egr1 expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
regenerating fin fn1b expression decreased amount, abnormal il11rabns251/bns251 amputation: caudal fin Fig. 3. with image from Allanki et al., 2021
cardiac ventricle elnb expression increased amount, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle elastic fiber assembly increased occurrence, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle transforming growth factor beta receptor signaling pathway increased occurrence, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
scale regeneration decreased process quality, abnormal il11rabns251/bns251 amputation: scale Fig. 2. with image from Allanki et al., 2021
cardiac ventricle regulation of receptor signaling pathway via JAK-STAT decreased occurrence, abnormal il11rabns251/bns251 ablation: heart Fig. 5. with image from Allanki et al., 2021
caudal fin fin regeneration decreased process quality, abnormal il11rabns251/bns251 amputation: caudal fin Fig. 2. with image from Allanki et al., 2021
cardiac ventricle regeneration decreased process quality, abnormal il11rabns251/bns251; ae1Tg/ae1Tg ablation: heart Fig. 4. with image from Allanki et al., 2021
cardiac ventricle EGFP expression decreased amount, abnormal il11rabns251/bns251; ae1Tg/ae1Tg ablation: heart Fig. 4. with image from Allanki et al., 2021
endocardium epithelial to mesenchymal transition increased occurrence, abnormal il11rabns251/bns251; cn9Tg/cn9Tg; cz1701Tg/cz1701Tg ablation: heart, chemical treatment by environment: afimoxifene Fig. 6. with image from Allanki et al., 2021
regenerating tissue retinol metabolic process decreased process quality, abnormal il11rabns251/bns251; hu4008Tg/hu4008Tg amputation: caudal fin Fig. 3. with image from Allanki et al., 2021
regenerating fin osteoblast EGFP expression decreased amount, abnormal il11rabns251/bns251; hu4008Tg/hu4008Tg amputation: caudal fin Fig. 3. with image from Allanki et al., 2021
regenerating fin EGFP expression decreased amount, abnormal il11rabns251/bns251; hu4008Tg/hu4008Tg amputation: caudal fin Fig. 3. with image from Allanki et al., 2021
caudal fin fin regeneration decreased process quality, abnormal il11rabns251/bns251; hu4008Tg/hu4008Tg amputation: caudal fin Fig. 3. with image from Allanki et al., 2021
cardiac ventricle mesenchyme mylka expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
cardiac ventricle extracellular matrix secreting cell loxa expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
cardiac ventricle extracellular matrix secreting cell loxl2b expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
regenerating tissue blood vessel EGFP expression spatial pattern, abnormal il11rabns251/bns251; y1Tg/y1Tg amputation: caudal fin Fig. 5. with image from Allanki et al., 2021
regenerating tissue endocardium EGFP expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle extracellular matrix secreting cell col1a1b expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
cardiac ventricle regeneration fibroblast Ab7-acta2 labeling spatial pattern, abnormal il11rabns251/bns251; y1Tg/y1Tg amputation: caudal fin Fig. 5. with image from Allanki et al., 2021
regenerating tissue transforming growth factor beta production increased occurrence, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 8. with image from Allanki et al., 2021
cardiac ventricle regeneration fibroblast zns-5 labeling spatial pattern, abnormal il11rabns251/bns251; y1Tg/y1Tg amputation: caudal fin Fig. 5. with image from Allanki et al., 2021
cardiac ventricle mesenchyme tgfb2 expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
regenerating tissue blood vessel EGFP expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 8. with image from Allanki et al., 2021
cardiac ventricle transforming growth factor beta receptor signaling pathway increased occurrence, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 8. with image from Allanki et al., 2021
endothelial cell tie1 expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
regenerating tissue endocardium increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
regenerating tissue endocardium ab1-elna labeling increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 5. with image from Allanki et al., 2021
cardiac ventricle extracellular matrix secreting cell elnb expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
cardiac ventricle mesenchyme acta2 expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
regenerating tissue endocardium ab2-smad3 labeling increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 8. with image from Allanki et al., 2021
cardiac ventricle mesenchyme snai1b expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
cardiac ventricle extracellular matrix secreting cell col1a1a expression increased amount, abnormal il11rabns251/bns251; y1Tg/y1Tg ablation: heart Fig. 6. with image from Allanki et al., 2021
cardiac muscle cell substrate-dependent cell migration, cell extension decreased process quality, abnormal il11rabns251/bns251; bns417Tg/bns417Tg; cn9Tg/cn9Tg ablation: heart Fig. 7. with image from Allanki et al., 2021
cardiac muscle cell substrate-dependent cell migration, cell extension decreased process quality, ameliorated il11rabns251/bns251; bns417Tg/bns417Tg; cn9Tg/cn9Tg ablation: heart, chemical treatment by environment: afimoxifene Fig. 7. with image from Allanki et al., 2021
cardiac ventricle regeneration fibroblast Ab7-acta2 labeling increased amount, abnormal il11rabns251/bns251; bns417Tg/bns417Tg; cn9Tg/cn9Tg ablation: heart Fig. 7. with image from Allanki et al., 2021
cardiac ventricle regeneration fibroblast Ab7-acta2 labeling amount, ameliorated il11rabns251/bns251; bns417Tg/bns417Tg; cn9Tg/cn9Tg ablation: heart, chemical treatment by environment: afimoxifene Fig. 7. with image from Allanki et al., 2021
Citations