CRISPR

CRISPR2-gne

ID

ZDB-CRISPR-240110-8

Name

CRISPR2-gne

Previous Names

None

Target

gne (1)

Sequence

5' - GAATGTCGGGCGCGAGACGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
rm4	gne

Expression

Gene expression in Wild Types + CRISPR2-gne

No data available

Phenotype

Phenotype resulting from CRISPR2-gne

No data available

Phenotype of all Fish created by or utilizing CRISPR2-gne

Phenotype	Fish	Conditions	Figures
trunk musculature skeletal muscle myofibril ab-f59 labeling spatial pattern, abnormal	gne^rm4/rm4	standard conditions	FIGURE 5 from Livne et al., 2022
whole organism hsp90aa1.1 expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
trunk musculature skeletal muscle myofibril disorganized, abnormal	gne^rm4/rm4	chemical treatment by environment: sialic acid	FIGURE 8 from Livne et al., 2022
whole organism smyd1b expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
heart contraction decreased rate, abnormal	gne^rm4/rm4	chemical treatment by environment: sialic acid	FIGURE 8 from Livne et al., 2022
whole organism dead, abnormal	gne^rm4/rm4	chemical treatment by environment: sialic acid	FIGURE 8 from Livne et al., 2022
whole organism si:dkey-31e10.5 expression decreased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
trunk musculature slow muscle cell ab-f59 labeling spatial pattern, abnormal	gne^rm4/rm4	standard conditions	FIGURE 5 , FIGURE 6 from Livne et al., 2022
heart contraction decreased rate, abnormal	gne^rm4/rm4	standard conditions	FIGURE 3 , FIGURE 8 from Livne et al., 2022
whole organism unc45b expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
swim bladder uninflated, abnormal	gne^rm4/rm4	chemical treatment by environment: sialic acid	FIGURE 8 from Livne et al., 2022
regulation of response to oxidative stress increased magnitude, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
whole organism si:ch211-198k9.6 expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
protein ubiquitination increased magnitude, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
whole organism curved, abnormal	gne^rm4/rm4	chemical treatment by environment: sialic acid	FIGURE 8 from Livne et al., 2022
whole organism brat1 expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
detection of mechanical stimulus involved in sensory perception of touch decreased process quality, abnormal	gne^rm4/rm4	standard conditions	FIGURE 3 from Livne et al., 2022
whole organism actb1 expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
whole organism cryba1l2 expression decreased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
metabolic process increased magnitude, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
trunk musculature fast muscle cell ab1-actn labeling spatial pattern, abnormal	gne^rm4/rm4	standard conditions	FIGURE 6 from Livne et al., 2022
cell cycle increased magnitude, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
swim bladder uninflated, abnormal	gne^rm4/rm4	standard conditions	FIGURE 2 , FIGURE 8 from Livne et al., 2022
visual behavior increased magnitude, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
trunk musculature skeletal muscle myofibril disorganized, abnormal	gne^rm4/rm4	standard conditions	FIGURE 4 , FIGURE 5 , FIGURE 8 from Livne et al., 2022
whole organism dead, abnormal	gne^rm4/rm4	standard conditions	FIGURE 2 , FIGURE 8 from Livne et al., 2022
whole organism eef1a1a expression decreased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
whole organism curved, abnormal	gne^rm4/rm4	standard conditions	FIGURE 2 , FIGURE 8 from Livne et al., 2022
whole organism rbbp6 expression increased amount, abnormal	gne^rm4/rm4	standard conditions	FIGURE 9 from Livne et al., 2022
heart contraction decreased rate, abnormal	gne^rm4/rm4; rm2Tg/rm2Tg	standard conditions	FIGURE 8 from Livne et al., 2022
whole organism curved, abnormal	gne^rm4/rm4; rm2Tg/rm2Tg	standard conditions	FIGURE 8 from Livne et al., 2022
whole organism dead, abnormal	gne^rm4/rm4; rm2Tg/rm2Tg	standard conditions	FIGURE 8 from Livne et al., 2022
swim bladder uninflated, abnormal	gne^rm4/rm4; rm2Tg/rm2Tg	standard conditions	FIGURE 8 from Livne et al., 2022
trunk musculature skeletal muscle myofibril disorganized, abnormal	gne^rm4/rm4; rm2Tg/rm2Tg	standard conditions	FIGURE 8 from Livne et al., 2022
heart contraction decreased rate, abnormal	gne^rm4/rm4; rm3Tg/rm3Tg	standard conditions	FIGURE 8 from Livne et al., 2022
whole organism curved, abnormal	gne^rm4/rm4; rm3Tg/rm3Tg	standard conditions	FIGURE 8 from Livne et al., 2022
whole organism dead, abnormal	gne^rm4/rm4; rm3Tg/rm3Tg	standard conditions	FIGURE 8 from Livne et al., 2022
swim bladder uninflated, abnormal	gne^rm4/rm4; rm3Tg/rm3Tg	standard conditions	FIGURE 8 from Livne et al., 2022
trunk musculature skeletal muscle myofibril disorganized, abnormal	gne^rm4/rm4; rm3Tg/rm3Tg	standard conditions	FIGURE 8 from Livne et al., 2022

Citations