CRISPR

CRISPR1-atm

ID

ZDB-CRISPR-231031-7

Name

CRISPR1-atm

Previous Names

None

Target

atm (1)

Sequence

5' - TGCGTCTTCGGAGCTCAACGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3863	atm

Expression

Gene expression in Wild Types + CRISPR1-atm

No data available

Phenotype

Phenotype resulting from CRISPR1-atm

No data available

Phenotype of all Fish created by or utilizing CRISPR1-atm

Phenotype	Fish	Conditions	Figures
spleen cystic, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
caudal fin decreased pigmentation, abnormal	atm^{zf3863/zf3863} (TU)	amputation: caudal fin	Figure 3 from Chen et al., 2022
kidney lymphocyte decreased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
whole organism viability, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 3 from Chen et al., 2022
female organism absence of anatomical entity, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 1 from Chen et al., 2022
kidney mpx expression increased distribution, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
sperm absence of anatomical entity, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 1 from Chen et al., 2022
kidney swollen, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 3 , Figure 4 from Chen et al., 2022
common myeloid progenitor decreased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 3 from Chen et al., 2022
kidney neoplastic, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
kidney inflammatory response increased process quality, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 3 from Chen et al., 2022
thymus rag1 expression decreased distribution, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 3 from Chen et al., 2022
kidney common lymphoid progenitor increased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
common lymphoid progenitor decreased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 3 from Chen et al., 2022
spleen increased size, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
caudal fin atm expression decreased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 1 from Chen et al., 2022
testis spermatogenesis decreased process quality, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 1 from Chen et al., 2022
eye neoplastic, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
kidney monocyte increased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
spermatid decreased amount, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 1 from Chen et al., 2022
swimming behavior decreased process quality, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 2 from Chen et al., 2022
kidney cystic, abnormal	atm^{zf3863/zf3863} (TU)	standard conditions	Figure 4 from Chen et al., 2022
caudal fin atm expression decreased amount, abnormal	atm^zf3863/+ (TU)	standard conditions	Figure 1 from Chen et al., 2022

Citations