CRISPR

CRISPR1-sacs

ID
ZDB-CRISPR-231003-1
Name
CRISPR1-sacs
Previous Names
None
Target
Sequence
5' - GGACCAATGGAGGGACCCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
irc1 sacs
Expression
Gene expression in Wild Types + CRISPR1-sacs
No data available
Phenotype
Phenotype resulting from CRISPR1-sacs
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sacs
Phenotype Fish Conditions Figures
locomotory behavior process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 4 with image from Naef et al., 2021
retinal pigmented epithelium decreased thickness, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
whole organism sacs expression decreased amount, abnormal sacsirc1/irc1 standard conditions Figure 1 with image from Naef et al., 2021
whole organism vim expression decreased amount, abnormal sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
cranial nerve II increased thickness, abnormal sacsirc1/irc1 standard conditions Fig. 3 with image from Naef et al., 2025
detection of light stimulus involved in visual perception increased sensitivity of a process detection of light stimulus, abnormal sacsirc1/irc1 standard conditions Fig. 6 with image from Naef et al., 2025
retinal cone cell morphology, abnormal sacsirc1/irc1 standard conditions Fig. 5 with image from Naef et al., 2025
eye area, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
retinal inner nuclear layer decreased thickness, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
locomotory behavior process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 4 with image from Naef et al., 2021
Muller cell morphology, abnormal sacsirc1/irc1 standard conditions Fig. 8 with image from Naef et al., 2025
whole organism vim expression decreased amount, abnormal sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
whole organism ttpa expression decreased amount, abnormal sacsirc1/irc1 standard conditions Fig. 7 with image from Naef et al., 2025
eye decreased area, abnormal sacsirc1/irc1 control Figure 5 with image from Naef et al., 2021
visual behavior disrupted, abnormal sacsirc1/irc1 standard conditions Fig. 2 with image from Naef et al., 2025
whole organism suox expression increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 7 with image from Naef et al., 2025
whole organism mitochondrion decreased functionality, abnormal sacsirc1/irc1 control Figure 3 with imageFigure 5 with image from Naef et al., 2021
eye decreased size, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
whole organism mitochondrion functionality, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
optomotor response process quality, abnormal sacsirc1/irc1 standard conditions Fig. 2 with image from Naef et al., 2025
whole organism apoptotic process occurrence, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
retinal ganglion cell layer apoptotic process increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 4 with image from Naef et al., 2025
retina inflammatory response increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 8 with image from Naef et al., 2025
retinal ganglion cell layer decreased thickness, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
swimming decreased linear velocity, abnormal sacsirc1/irc1 control Figure 2 with imageFigure 4 with image from Naef et al., 2021
visually-mediated background adaptation disrupted, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
retina dysplastic, abnormal sacsirc1/irc1 standard conditions Fig. 5 with image from Naef et al., 2025
whole organism apoptotic process increased occurrence, abnormal sacsirc1/irc1 control Figure 5 with image from Naef et al., 2021
Purkinje cell ab1-pvalb7 labeling decreased amount, abnormal sacsirc1/irc1 standard conditions Figure 2 with image from Naef et al., 2021
whole organism vkorc1 expression increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 7 with image from Naef et al., 2025
retina mitotic M phase increased duration, abnormal sacsirc1/irc1 standard conditions Fig. 3 with image from Naef et al., 2025
swimming process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 4 with image from Naef et al., 2021
amacrine cell ab1-elavl labeling increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 5 with image from Naef et al., 2025
eye decreased size, abnormal sacsirc1/irc1 standard conditions Figure 1 with image from Naef et al., 2021
whole organism calr expression increased amount, abnormal sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
whole organism reactive oxygen species increased amount, abnormal sacsirc1/irc1 standard conditions Figure 3 with image from Naef et al., 2021
retinal inner nuclear layer apoptotic process increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 4 with image from Naef et al., 2025
whole organism vim expression increased amount, abnormal sacsirc1/irc1 control Figure 3 with imageFigure 5 with image from Naef et al., 2021
swimming process quality, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 4 with image from Naef et al., 2021
locomotory behavior decreased process quality, abnormal sacsirc1/irc1 control Figure 2 with imageFigure 4 with image from Naef et al., 2021
eye apoptotic process increased occurrence, abnormal sacsirc1/irc1 standard conditions Figure 3 with image from Naef et al., 2021
retina cell population proliferation increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 3 with image from Naef et al., 2025
Muller cell ab-4c4 labeling spatial pattern, abnormal sacsirc1/irc1 standard conditions Fig. 8 with image from Naef et al., 2025
retinal outer nuclear layer apoptotic process increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 4 with image from Naef et al., 2025
retina layer formation process quality, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
retina Ab22-gfap labeling increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 8 with image from Naef et al., 2025
retinal outer nuclear layer decreased thickness, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
Muller cell glial cell activation increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 8 with image from Naef et al., 2025
retinal rod cell morphology, abnormal sacsirc1/irc1 standard conditions Fig. 5 with image from Naef et al., 2025
retinal rod cell ab3-rho labeling increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 5 with image from Naef et al., 2025
whole organism calr expression decreased amount, abnormal sacsirc1/irc1 control Figure 3 with imageFigure 5 with image from Naef et al., 2021
whole organism calr expression amount, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
retina decreased thickness, abnormal sacsirc1/irc1 standard conditions Fig. 1 with image from Naef et al., 2025
whole organism mitochondrion functionality, ameliorated sacsirc1/irc1 chemical treatment by environment: N-acetyl-L-leucine Figure 5 with image from Naef et al., 2021
whole organism tnfa expression increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 8 with image from Naef et al., 2025
retina apoptotic process increased occurrence, abnormal sacsirc1/irc1 standard conditions Fig. 4 with image from Naef et al., 2025
amacrine cell increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 5 with image from Naef et al., 2025
whole organism ab2-sqstm1 labeling decreased amount, abnormal sacsirc1/irc1 standard conditions Figure 3 with image from Naef et al., 2021
whole organism rdh5 expression decreased amount, abnormal sacsirc1/irc1 standard conditions Fig. 7 with image from Naef et al., 2025
whole organism apoptotic process occurrence, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
whole organism epx expression increased amount, abnormal sacsirc1/irc1 standard conditions Fig. 7 with image from Naef et al., 2025
eye area, ameliorated sacsirc1/irc1 chemical treatment by environment: tauroursodeoxycholic acid Figure 5 with image from Naef et al., 2021
Purkinje cell decreased amount, abnormal sacsirc1/irc1; bz6Tg standard conditions Figure 2 with image from Naef et al., 2021
cerebellum decreased area, abnormal sacsirc1/irc1; bz6Tg standard conditions Figure 2 with image from Naef et al., 2021
Citations