CRISPR

CRISPR1-ptprz1b

ID

ZDB-CRISPR-230824-4

Name

CRISPR1-ptprz1b

Previous Names

None

Target

ptprz1b (1)

Sequence

5' - AGGTCAGCGCAAATTCACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
aa65	ptprz1b

Expression

Gene expression in Wild Types + CRISPR1-ptprz1b

No data available

Phenotype

Phenotype resulting from CRISPR1-ptprz1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ptprz1b

Phenotype	Fish	Conditions	Figures
whole organism notch1b expression decreased distribution, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
bulbus arteriosus ab1-elnb labeling decreased distribution, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 7 from Katraki-Pavlou et al., 2021
cardiac ventricle increased width, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. S7 from Katraki-Pavlou et al., 2021
cardiac ventricle klf2a expression spatial pattern, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
ventricular myocardium ab-mf20 labeling increased distribution, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. S7 from Katraki-Pavlou et al., 2021
whole organism ptprz1b expression decreased amount, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. S5 from Katraki-Pavlou et al., 2021
cardiac ventricle increased length, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. S7 from Katraki-Pavlou et al., 2021
cardiac ventricle bmp4 expression spatial pattern, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
atrioventricular canal notch1b expression decreased distribution, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
cardiac ventricle increased area, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 7 , Fig. S7 from Katraki-Pavlou et al., 2021
bulbus arteriosus increased length, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 6 from Katraki-Pavlou et al., 2021
heart contraction decreased rate, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 3 from Katraki-Pavlou et al., 2021
bulbus arteriosus increased area, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 6 from Katraki-Pavlou et al., 2021
bulbus arteriosus lumen increased size, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 7 from Katraki-Pavlou et al., 2021
whole organism ttn.2 expression decreased amount, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. S7 from Katraki-Pavlou et al., 2021
bulbus arteriosus ab1-elnb labeling increased distribution, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 6 from Katraki-Pavlou et al., 2021
whole organism gata4 expression decreased amount, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
whole organism tbx2b expression increased amount, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
heart contraction process quality, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 3 from Katraki-Pavlou et al., 2021
cardiac ventricle bmp4 expression decreased distribution, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 5 from Katraki-Pavlou et al., 2021
cardiac ventricle myocardium decreased thickness, abnormal	ptprz1b^aa65/aa65; ia5Tg; s843Tg (AB)	standard conditions	Fig. 7 from Katraki-Pavlou et al., 2021

Citations