CRISPR

CRISPR1-atg13

ID

ZDB-CRISPR-230725-7

Name

CRISPR1-atg13

Previous Names

None

Target

atg13 (1)

Sequence

5' - GTTATAGTGCAAGCCCGGCT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fci500	atg13

Expression

Gene expression in Wild Types + CRISPR1-atg13

No data available

Phenotype

Phenotype resulting from CRISPR1-atg13

No data available

Phenotype of all Fish created by or utilizing CRISPR1-atg13

Phenotype	Fish	Conditions	Figures
Meckel's cartilage Ab2-sox9a labeling decreased distribution, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 6 from Moss et al., 2021
whole organism dead, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 1 from Moss et al., 2021
trunk bent, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 1 from Moss et al., 2021
whole organism Ab6-sqstm1 labeling increased amount, abnormal	atg13^{fci500/fci500}	chemical treatment by environment: bafilomycin A1	Fig. 2 from Moss et al., 2021
chondrocyte exocytic vesicle decreased amount, abnormal	atg13^{fci500/fci500}	chemical treatment by environment: bafilomycin A1	Fig. 7 from Moss et al., 2021
whole organism semi-viable, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 1 from Moss et al., 2021
whole organism Ab6-sqstm1 labeling increased amount, abnormal	atg13^{fci500/fci500}	control	Fig. 2 from Moss et al., 2021
ventral mandibular arch Ab2-sox9a labeling decreased distribution, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 6 from Moss et al., 2021
oral cavity movement quality, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 3 from Moss et al., 2021
chondrocyte amphisome absence of anatomical entity, abnormal	atg13^{fci500/fci500}	chemical treatment by environment: bafilomycin A1	Fig. 7 from Moss et al., 2021
chondrocyte exocytic vesicle decreased amount, abnormal	atg13^{fci500/fci500}	control	Fig. 7 from Moss et al., 2021
mouth movement quality, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 3 from Moss et al., 2021
ventral mandibular arch chondrocyte decreased amount, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 5 from Moss et al., 2021
whole organism viability, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 1 from Moss et al., 2021
swim bladder uninflated, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 1 from Moss et al., 2021
chondrocyte autophagosome absence of anatomical entity, abnormal	atg13^{fci500/fci500}	chemical treatment by environment: bafilomycin A1	Fig. 7 from Moss et al., 2021
whole organism decreased length, abnormal	atg13^{fci500/fci500}	standard conditions	Fig. 1 from Moss et al., 2021
whole organism Ab6-sqstm1 labeling increased amount, abnormal	atg13^fci500/+	chemical treatment by environment: bafilomycin A1	Fig. 2 from Moss et al., 2021
ventral mandibular arch cell population proliferation decreased process quality, abnormal	atg13^{fci500/fci500}; hu5910Tg	standard conditions	Fig. 5 from Moss et al., 2021
ventral mandibular arch hypertrophic chondrocyte increased amount, abnormal	atg13^{fci500/fci500}; hu5910Tg	standard conditions	Fig. 6 from Moss et al., 2021
ventral mandibular arch hypertrophic chondrocyte Ab3-col10a1 labeling increased distribution, abnormal	atg13^{fci500/fci500}; hu5910Tg	standard conditions	Fig. 6 from Moss et al., 2021
Meckel's cartilage hypertrophic chondrocyte Ab3-col10a1 labeling increased distribution, abnormal	atg13^{fci500/fci500}; hu5910Tg	standard conditions	Fig. 6 from Moss et al., 2021
Meckel's cartilage hypertrophic chondrocyte increased amount, abnormal	atg13^{fci500/fci500}; hu5910Tg	standard conditions	Fig. 6 from Moss et al., 2021

Citations