CRISPR

CRISPR1-bmp7b

ID

ZDB-CRISPR-221117-2

Name

CRISPR1-bmp7b

Previous Names

None

Target

bmp7b (1)

Sequence

5' - GGGCGTTGTGCTTGCCGTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first "G" was added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3599	bmp7b

Expression

Gene expression in Wild Types + CRISPR1-bmp7b

No data available

Phenotype

Phenotype resulting from CRISPR1-bmp7b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-bmp7b

Phenotype	Fish	Conditions	Figures
integument gna14 expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
whole organism decreased weight, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 3 from Dong et al., 2022
integument melanocyte increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
eye bmp7b expression decreased distribution, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 5 from Dong et al., 2022
whole organism ghra expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
whole organism igf2r expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
eye rcvrn2 expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
whole organism decreased length, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 3 from Dong et al., 2022
whole organism ghrb expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
eye bambia expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
hemal arch curved, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 3 from Dong et al., 2022
whole organism igf2b expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
whole organism low brightness, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 3 from Dong et al., 2022
whole organism igf1 expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
whole organism igf1rb expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
retinal pigmented epithelium increased thickness, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 5 from Dong et al., 2022
integument melanocyte increased distribution, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
eye erbb3b expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
eye rgs9b expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
whole organism gh1 expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
eye wnt7ba expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
iris increased ratio eye, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 5 from Dong et al., 2022
iris increased diameter, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 5 from Dong et al., 2022
whole organism igf1ra expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
eye opn1mw4 expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
whole organism igf2a expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 2 from Dong et al., 2022
eye gna14 expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
integument wnt7ba expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
integument bambia expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
intermuscular bone nodular, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 3 from Dong et al., 2022
integument erbb3b expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
eye grk1b expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
integument bmp7b expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
eye rgs9a expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
eye gc2 expression increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
eye bmp7b expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022
integument Melanin increased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 4 from Dong et al., 2022
eye guca1d expression decreased amount, abnormal	bmp7b^{zf3599/zf3599}	standard conditions	FIGURE 6 from Dong et al., 2022

Citations