CRISPR

CRISPR1-sema6ca

ID
ZDB-CRISPR-220316-2
Name
CRISPR1-sema6ca
Previous Names
  • CRISPR1-sema6d
Target
Sequence
5' - GTTTACTCACTCTGTAGTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ca302 sema6ca
Expression
Gene expression in Wild Types + CRISPR1-sema6ca
No data available
Phenotype
Phenotype resulting from CRISPR1-sema6ca
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sema6ca
Phenotype Fish Conditions Figures
optic cup postero-lateral region vax2 expression decreased distribution, abnormal sema6caca302/ca302 (TL) chemical treatment by environment: dasatinib monohydrate Figure 9. with image from Cechmanek et al., 2021
optic cup ventral region vax2 expression decreased distribution, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
presumptive retinal pigmented epithelium vax2 expression mislocalised, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
optic cup postero-lateral region foxd1 expression decreased distribution, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
optic cup morphogenesis involved in camera-type eye development decreased process quality, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
optic cup postero-lateral region vax2 expression spatial pattern, abnormal sema6caca302/ca302 (TL) control Figure 9. with image from Cechmanek et al., 2021
optic cup postero-lateral region foxd1 expression spatial pattern, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
presumptive retinal pigmented epithelium cell cuboid, abnormal sema6caca302/ca302 (TL) standard conditions Figure 5. with image from Cechmanek et al., 2021
optic cup postero-lateral region vax2 expression decreased distribution, abnormal sema6caca302/ca302 (TL) control Figure 9. with image from Cechmanek et al., 2021
presumptive neural retina bhlhe40 expression mislocalised, abnormal sema6caca302/ca302 (TL) standard conditions Figure 5. with image from Cechmanek et al., 2021
optic cup morphogenesis involved in camera-type eye development decreased process quality, abnormal sema6caca302/ca302 (TL) chemical treatment by environment: dasatinib monohydrate Figure 9. with image from Cechmanek et al., 2021
optic cup ventral region vax2 expression spatial pattern, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
presumptive retinal pigmented epithelium foxd1 expression mislocalised, abnormal sema6caca302/ca302 (TL) standard conditions Figure 4. with image from Cechmanek et al., 2021
optic cup postero-lateral region vax2 expression spatial pattern, abnormal sema6caca302/ca302 (TL) chemical treatment by environment: dasatinib monohydrate Figure 9. with image from Cechmanek et al., 2021
retinal pigment epithelium development decreased process quality, abnormal sema6caca302/ca302 (TL) standard conditions Figure 5. with image from Cechmanek et al., 2021
optic cup cell motility involved in camera-type eye morphogenesis decreased linear velocity, abnormal sema6caca302/+; mw68Tg standard conditions Figure 7. with image from Cechmanek et al., 2021
presumptive neural retina EGFP expression mislocalised, abnormal sema6caca302/ca302; mw68Tg standard conditions Figure 5. with image from Cechmanek et al., 2021
presumptive retinal pigmented epithelium foxd1 expression mislocalised, abnormal sema6caca302/ca302; mw68Tg standard conditions Figure 5. with image from Cechmanek et al., 2021
retinal pigment epithelium development decreased process quality, abnormal sema6caca302/ca302; mw68Tg standard conditions Figure 5. with image from Cechmanek et al., 2021
optic cup cell motility involved in camera-type eye morphogenesis decreased linear velocity, abnormal sema6caca302/ca302; mw68Tg standard conditions Figure 7. with image from Cechmanek et al., 2021
optic cup morphogenesis involved in camera-type eye development decreased process quality, abnormal sema6caca302/ca302; zf460Tg standard conditions Figure 6. with image from Cechmanek et al., 2021
presumptive neural retina neuroepithelial cell disoriented, abnormal sema6caca302/ca302; zf460Tg standard conditions Figure 6. with image from Cechmanek et al., 2021
optic cup cell motility involved in camera-type eye morphogenesis decreased linear velocity, abnormal sema6caca302/ca302; zf460Tg standard conditions Figure 7. with image from Cechmanek et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.