CRISPR

CRISPR1-alx3

ID
ZDB-CRISPR-220224-2
Name
CRISPR1-alx3
Previous Names
None
Target
Sequence
5' - GGCGTCCAACGGCTTGACTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
dco3003 alx3
dco3004 alx3
Expression
Gene expression in Wild Types + CRISPR1-alx3
No data available
Phenotype
Phenotype resulting from CRISPR1-alx3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-alx3
Phenotype Fish Conditions Figures
ethmoid cartilage increased length, abnormal alx3dco3003/dco3003 standard conditions Fig. 4 with image from Mitchell et al., 2021
ethmoid cartilage decreased width, abnormal alx3dco3003/dco3003 standard conditions Fig. 4 with image from Mitchell et al., 2021
parasphenoid decreased area, abnormal alx3dco3003/dco3003 standard conditions Fig. 4 with image from Mitchell et al., 2021
ethmoid cartilage cell morphology, abnormal alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
parasphenoid absence of anatomical entity, abnormal alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cartilaginous projection mislocalised, abnormal alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage increased length, abnormal alx3dco3004/dco3004 standard conditions Fig. 4 with image from Mitchell et al., 2021
ethmoid cartilage decreased width, abnormal alx3dco3004/dco3004 standard conditions Fig. 4 with image from Mitchell et al., 2021
parasphenoid decreased area, abnormal alx3dco3004/dco3004 standard conditions Fig. 4 with image from Mitchell et al., 2021
ethmoid cartilage cartilaginous projection mislocalised, abnormal alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cell morphology, abnormal alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage chondrocyte development premature, abnormal alx3dco3003/dco3003; sox9azc81Tg; vu234Tg standard conditions Fig. 6 with image from Mitchell et al., 2021
ethmoid cartilage chondrocyte increased amount, abnormal alx3dco3003/dco3003; sox9azc81Tg; vu234Tg standard conditions Fig. 6 with image from Mitchell et al., 2021
ethmoid cartilage chondrocyte development premature, abnormal alx3dco3004/dco3004; sox9azc81Tg; vu234Tg standard conditions Fig. 6 with image from Mitchell et al., 2021
ethmoid cartilage chondrocyte increased amount, abnormal alx3dco3004/dco3004; sox9azc81Tg; vu234Tg standard conditions Fig. 6 with image from Mitchell et al., 2021
ethmoid cartilage cartilaginous projection mislocalised, abnormal tfap2ats213/+; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cell morphology, abnormal tfap2ats213/+; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
parasphenoid absence of anatomical entity, abnormal tfap2ats213/+; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cell morphology, abnormal tfap2ats213/+; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
parasphenoid amount, ameliorated tfap2ats213/+; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cartilaginous projection mislocalised, exacerbated tfap2ats213/+; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
parasphenoid mislocalised, abnormal tfap2ats213/ts213; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cartilaginous projection mislocalised, exacerbated tfap2ats213/ts213; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
parasphenoid amount, exacerbated tfap2ats213/ts213; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
eye cartilage tissue mislocalised, exacerbated tfap2ats213/ts213; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage medial side split, exacerbated tfap2ats213/ts213; alx3dco3003/+ (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage cartilaginous projection mislocalised, exacerbated tfap2ats213/ts213; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
ethmoid cartilage medial side split, exacerbated tfap2ats213/ts213; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
parasphenoid mislocalised, exacerbated tfap2ats213/ts213; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
eye cartilage tissue mislocalised, exacerbated tfap2ats213/ts213; alx3dco3003/dco3003 (AB) standard conditions Fig. 6. with image from Nguyen et al., 2023
Citations