CRISPR

CRISPR1-mia2

ID

ZDB-CRISPR-211028-1

Name

CRISPR1-mia2

Previous Names

None

Target

mia2 (1)

Sequence

5' - GGCCGCAAGGGCAGCTGATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mw91	mia2

Expression

Gene expression in Wild Types + CRISPR1-mia2

No data available

Phenotype

Phenotype resulting from CRISPR1-mia2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-mia2

Phenotype	Fish	Conditions	Figures
whole organism mia2 expression decreased amount, abnormal	mia2^mw91/mw91	standard conditions	Fig. S2 from Clark et al., 2021
whole organism decreased life span, abnormal	mia2^mw91/mw91	standard conditions	Fig. S3, text only from Clark et al., 2021
intersegmental vessel lipoprotein transport decreased process quality, abnormal	mia2^mw91/mw91	standard conditions	Fig. 3 from Clark et al., 2021
whole organism decreased length, abnormal	mia2^mw91/mw91	standard conditions	Fig. 1 from Clark et al., 2021
yolk low brightness, abnormal	mia2^mw91/mw91	standard conditions	Fig. 1 from Clark et al., 2021
brain lysosome increased amount, abnormal	mia2^mw91/mw91	standard conditions	Fig. 4 from Clark et al., 2021
lens epithelium morphology, abnormal	mia2^mw91/mw91	standard conditions	Fig. 2 from Clark et al., 2021
whole organism decreased weight, abnormal	mia2^mw91/mw91	standard conditions	Fig. 1 from Clark et al., 2021
optic tectum EGFP expression increased amount, abnormal	mia2^mw91/mw91; mil1Tg	standard conditions	Fig. 4 from Clark et al., 2021
medulla oblongata EGFP expression increased amount, abnormal	mia2^mw91/mw91; mil1Tg	standard conditions	Fig. 4 from Clark et al., 2021
telencephalon EGFP expression increased amount, abnormal	mia2^mw91/mw91; mil1Tg	standard conditions	Fig. 4 from Clark et al., 2021
cerebellum EGFP expression increased amount, abnormal	mia2^mw91/mw91; mil1Tg	standard conditions	Fig. 4 from Clark et al., 2021
spinal cord lysosome increased amount, abnormal	mia2^mw91/mw91; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
spinal cord d2EGFP expression increased distribution, abnormal	mia2^mw91/mw91; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
trunk muscle d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
intestine d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
spinal cord d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
head deformed, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
mouth decreased length, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism dead, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism decreased life span, abnormal	mia2^mw91/+; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
pharyngeal arch cartilage ab1-col2a labeling spatial pattern, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 3 from Clark et al., 2021
chondrocyte endoplasmic reticulum distended, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 3 from Clark et al., 2021
whole organism decreased weight, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 1 from Clark et al., 2021
whole organism decreased length, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 1 from Clark et al., 2021
intersegmental vessel lipoprotein transport decreased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 3 from Clark et al., 2021
yolk low brightness, abnormal	mia2^mw91/mw91; mia3^mw92/+	standard conditions	Fig. 1 from Clark et al., 2021
caudal vein increased accumulation nucleate erythrocyte, exacerbated	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
sclera apoptotic process increased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
lens degenerate, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
head deformed, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
whole organism dead, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
mouth decreased length, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
heart anatomical structure quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
cranial cartilage absent, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
lens apoptotic process increased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
whole organism decreased life span, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
cranial cartilage morphology, exacerbated	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 2 from Clark et al., 2021
brain apoptotic process increased process quality, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 4 from Clark et al., 2021
yolk low brightness, abnormal	mia2^mw91/mw91; mia3^mw92/mw92	standard conditions	Fig. 1 from Clark et al., 2021
spinal cord cell decreased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
trunk muscle d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
ventral mandibular arch d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 5 from Clark et al., 2021
spinal cord d2EGFP expression increased amount, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021
spinal cord d2EGFP expression increased distribution, abnormal	mia2^mw91/mw91; mia3^mw92/mw92; mw85Tg	standard conditions	Fig. 4 from Clark et al., 2021

Citations