CRISPR

CRISPR4-mettl3

ID
ZDB-CRISPR-211007-2
Name
CRISPR4-mettl3
Previous Names
None
Target
Sequence
5' - GGGAGATGCACTGGGGCCAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hzu103 mettl3
hzu104 mettl3
Expression
Gene expression in Wild Types + CRISPR4-mettl3
No data available
Phenotype
Phenotype resulting from CRISPR4-mettl3
No data available
Phenotype of all Fish created by or utilizing CRISPR4-mettl3
Phenotype Fish Conditions Figures
vasculature development process quality, abnormal mettl3hzu103/hzu103 standard conditions Fig. 3 from Parial et al., 2021
whole organism Ab1-phlpp2 labeling increased amount, abnormal mettl3hzu103/hzu103 standard conditions Fig. 6 from Parial et al., 2021
whole organism Ab17-akt labeling decreased amount, abnormal mettl3hzu103/hzu103 standard conditions Fig. 6 from Parial et al., 2021
whole organism Ab18-akt labeling increased amount, abnormal mettl3hzu103/hzu103 standard conditions Fig. 6 from Parial et al., 2021
mRNA m(6)A methyltransferase activity decreased occurrence, abnormal mettl3hzu103/hzu103 standard conditions Fig. S1 from Parial et al., 2021
whole organism lacks parts or has fewer parts of type intersegmental vessel, abnormal mettl3hzu103/hzu103 standard conditions Fig. 3 from Parial et al., 2021
intersegmental vein morphology, abnormal mettl3hzu103/hzu103 standard conditions Fig. 3 from Parial et al., 2021
whole organism Ab2-mettl3 labeling decreased amount, abnormal mettl3hzu103/hzu103 standard conditions Fig. 6,  Fig. S1 from Parial et al., 2021
vasculature development process quality, abnormal mettl3hzu103/+ standard conditions Fig. 3 from Parial et al., 2021
subintestinal vein decreased branchiness, abnormal mettl3hzu103/+ standard conditions Fig. 2 from Parial et al., 2021
mRNA m(6)A methyltransferase activity decreased occurrence, abnormal mettl3hzu103/+ standard conditions Fig. S1 from Parial et al., 2021
subintestinal vein morphology, abnormal mettl3hzu103/+ standard conditions Fig. 2 from Parial et al., 2021
interconnecting vessels decreased branchiness, abnormal mettl3hzu103/+ standard conditions Fig. 2 from Parial et al., 2021
whole organism Ab2-mettl3 labeling decreased amount, abnormal mettl3hzu103/+ standard conditions Fig. S1 from Parial et al., 2021
whole organism lacks parts or has fewer parts of type intersegmental vessel, abnormal mettl3hzu103/+ standard conditions Fig. 3 from Parial et al., 2021
intersegmental vein morphology, abnormal mettl3hzu103/+ standard conditions Fig. 3 from Parial et al., 2021
dorsal longitudinal anastomotic vessel morphology, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 2 from Parial et al., 2021
intersegmental vessel morphology, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 1 from Parial et al., 2021
dorsal longitudinal anastomotic vessel decreased branchiness, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 2 from Parial et al., 2021
subintestinal vein morphology, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 2 from Parial et al., 2021
intersegmental vessel decreased length, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 1 from Parial et al., 2021
whole organism lacks parts or has fewer parts of type intersegmental vessel, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 1 from Parial et al., 2021
subintestinal vein decreased branchiness, abnormal mettl3hzu103/+; la116Tg standard conditions Fig. 2 from Parial et al., 2021
intersegmental vessel morphology, abnormal mettl3hzu103/+; y1Tg standard conditions Fig. 1 from Parial et al., 2021
whole organism lacks parts or has fewer parts of type intersegmental vessel, abnormal mettl3hzu103/+; y1Tg standard conditions Fig. 1 from Parial et al., 2021
intersegmental vessel decreased length, abnormal mettl3hzu103/+; y1Tg standard conditions Fig. 1 from Parial et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.