CRISPR

CRISPR3-nrl

ID

ZDB-CRISPR-210805-3

Name

CRISPR3-nrl

Previous Names

None

Target

nrl (1)

Sequence

5' - GCTGGACGGGAGCCCTTCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ua5009	nrl
ua5014	nrl

Expression

Gene expression in Wild Types + CRISPR3-nrl

No data available

Phenotype

Phenotype resulting from CRISPR3-nrl

No data available

Phenotype of all Fish created by or utilizing CRISPR3-nrl

Phenotype	Fish	Conditions	Figures
retina quality of interaction of a substance with electromagnetic radiation, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 6 from Oel et al., 2020
short single cone cell ab1-10c9.1 labeling increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Fig. 2 from Neil et al., 2024
retinal rod cell decreased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 1 from Oel et al., 2020
retina nrl expression increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 5 from Oel et al., 2020
retina nr2e3 expression decreased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 5 from Oel et al., 2020
retina increased size, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 6 from Oel et al., 2020
short single cone cell increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 1 from Oel et al., 2020
retinal rod cell ab-4c12 labeling decreased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Fig. 2 from Neil et al., 2024 Figure 1 from Oel et al., 2020
retina synaptic ribbon increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 6 from Oel et al., 2020
whole organism tbx2b expression increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Fig. 4 from Neil et al., 2024
whole organism rho expression decreased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Fig. 4 from Neil et al., 2024
retinal rod cell Ab1-Nrl labeling decreased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 1 from Oel et al., 2020
whole organism nr2e3 expression decreased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Fig. 4 from Neil et al., 2024
retinal outer nuclear layer nrl expression increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Figure 5 from Oel et al., 2020
whole organism nrl expression increased amount, abnormal	nrl^{ua5009/ua5009}	standard conditions	Fig. 4 from Neil et al., 2024
retinal rod cell EGFP expression decreased amount, abnormal	nrl^{ua5009/ua5009}; kj2Tg/kj2Tg	standard conditions	Figure 4 from Oel et al., 2020
whole organism tbx2b expression increased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 4 from Neil et al., 2024
whole organism nr2e3 expression decreased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 4 from Neil et al., 2024
retinal rod cell synapse absent, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 3 from Neil et al., 2024
retinal rod cell ab-4c12 labeling decreased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 2 from Neil et al., 2024
whole organism nrl expression increased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 4 from Neil et al., 2024
whole organism rho expression decreased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 4 from Neil et al., 2024
short single cone cell ab1-10c9.1 labeling increased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 2 from Neil et al., 2024
whole organism opn1sw1 expression increased amount, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 4 from Neil et al., 2024
retinal cone cell photoreceptor outer segment membrane absent, abnormal	nrl^{ua5009/ua5009}; tbx2b^{p25bbtl/p25bbtl}	standard conditions	Fig. 3 from Neil et al., 2024
retinal rod cell shape, abnormal	nrl^{ua5009/ua5009}; ua3162Tg/ua3162Tg	standard conditions	Figure 2 from Oel et al., 2020

Citations