CRISPR

CRISPR1-tmem216

ID

ZDB-CRISPR-210312-1

Name

CRISPR1-tmem216

Previous Names

None

Target

tmem216 (1)

Sequence

5' - TCCTGTTTCATTTGAACGGCTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3394	tmem216
zf3395	tmem216

Expression

Gene expression in Wild Types + CRISPR1-tmem216

No data available

Phenotype

Phenotype resulting from CRISPR1-tmem216

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tmem216

Phenotype	Fish	Conditions	Figures
retinal cone cell cone photoreceptor outer segment ab2-gnat2 labeling absent, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
photoreceptor cell filamentous actin disorganized, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 6. from Liu et al., 2020
whole organism semi-viable, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Table 1 from Liu et al., 2020
retinal outer nuclear layer apoptotic process increased process quality, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 7. from Liu et al., 2020
whole organism dead, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Table 1 from Liu et al., 2020
long double cone cell cone photoreceptor outer segment ab3-rho labeling absent, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
retinal cone cell cell body ab2-gnat2 labeling mislocalised, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
retinal outer nuclear layer axoneme decreased amount, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 8. from Liu et al., 2020
long double cone cell cell body ab3-rho labeling mislocalised, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
retinal cone cell ab2-gnat2 labeling decreased distribution, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 3. from Liu et al., 2020
whole organism viability, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Table 1 from Liu et al., 2020
retinal outer nuclear layer axoneme ab1-tuba labeling decreased distribution, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 8. from Liu et al., 2020
retinal outer nuclear layer axoneme area density, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 8. from Liu et al., 2020
long double cone cell ab3-rho labeling decreased distribution, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 3. from Liu et al., 2020
retinal rod cell cell body ab5-rho labeling mislocalised, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 6. from Liu et al., 2020
retinal rod cell rod photoreceptor outer segment ab5-rho labeling decreased distribution, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 5. from Liu et al., 2020
retinal outer nuclear layer axoneme decreased length, abnormal	tmem216^{zf3394/zf3394} (AB/TU)	standard conditions	Figure 8. from Liu et al., 2020
eye photoreceptor cell vacuole increased amount, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 9. from Liu et al., 2020
retinal cone cell cone photoreceptor outer segment ab2-gnat2 labeling absent, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
whole organism semi-viable, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Table 1 from Liu et al., 2020
retinal cone cell cell body ab2-gnat2 labeling mislocalised, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
retinal outer nuclear layer apoptotic process increased process quality, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 7. from Liu et al., 2020
whole organism dead, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Table 1 from Liu et al., 2020
long double cone cell cone photoreceptor outer segment ab3-rho labeling absent, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
head ab2-gnat2 labeling decreased amount, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 3. from Liu et al., 2020
eye photoreceptor cell photoreceptor outer segment morphology, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 9. from Liu et al., 2020
retinal cone cell ab2-gnat2 labeling decreased distribution, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 3. from Liu et al., 2020
long double cone cell cell body ab3-rho labeling mislocalised, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 4. from Liu et al., 2020
whole organism viability, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Table 1 from Liu et al., 2020
eye photoreceptor cell photoreceptor disc membrane shortened, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 9. from Liu et al., 2020
long double cone cell ab3-rho labeling decreased distribution, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 3. from Liu et al., 2020
retinal rod cell rod photoreceptor outer segment ab5-rho labeling decreased distribution, abnormal	tmem216^{zf3395/zf3395} (AB/TU)	standard conditions	Figure 5. from Liu et al., 2020

Citations