CRISPR

CRISPR1-atp7a

ID
ZDB-CRISPR-200520-1
Name
CRISPR1-atp7a
Previous Names
None
Target
Sequence
5' - GGCCGGATCGGAGGCCTGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was AGG at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hza4 atp7a
Expression
Gene expression in Wild Types + CRISPR1-atp7a
No data available
Phenotype
Phenotype resulting from CRISPR1-atp7a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-atp7a
Phenotype Fish Conditions Figures
intestine hspa5 expression increased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
intestinal epithelial cell mitochondrial inner membrane swollen, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
whole organism cox4i2 expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
whole organism eif2ak3 expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
whole organism fabp2 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
whole organism hmox2a expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
intestine slc15a1b expression decreased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
intestine fabp2 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
retina opn1sw1 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
retina opn1sw1 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism eif2ak3 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism ern1 expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
whole organism cox4i2 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
retina mitochondrion swollen, abnormal atp7ahza4/hza4 standard conditions Fig. 7 with image from Zhao et al., 2020
whole organism cyp8b1.1 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
whole organism ern1 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
brain hspa5 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism hmox2a expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism rho expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism slc15a1b expression decreased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
brain ddit3 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism opn1sw1 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism znrf2a expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism cyp3a65 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
whole organism opn1sw2 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
intestine fabp2 expression decreased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
brain hspa5 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism loxa expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
whole organism opn1sw2 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism ern1 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism eif2ak3 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism opn1sw1 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism slc15a1b expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
intestinal epithelial cell endoplasmic reticulum structure, exacerbated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 6 from Zhao et al., 2019
whole organism rho expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
intestine hspa5 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
intestinal epithelial cell endoplasmic reticulum structure, exacerbated atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
whole organism znrf2a expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
whole organism atf6 expression increased amount, abnormal atp7ahza4/hza4 control Fig. 7 with image from Zhao et al., 2020
whole organism hmox2a expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
brain ddit3 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism cyp3a65 expression decreased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
whole organism loxa expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
retina mitochondrion swollen, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
intestinal epithelial cell mitochondrial inner membrane swollen, exacerbated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 6 from Zhao et al., 2019
whole organism znrf2a expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
retina opn1sw2 expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. S8 from Zhao et al., 2020
retina mitochondrion swollen, abnormal atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
whole organism cox4i2 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
whole organism cyp8b1.1 expression decreased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
whole organism atf6 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper atom Fig. 7 with image from Zhao et al., 2020
intestinal epithelial cell mitochondrial inner membrane swollen, exacerbated atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
whole organism fabp2 expression decreased amount, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
whole organism atf6 expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
intestinal epithelial cell endoplasmic reticulum loose, abnormal atp7ahza4/hza4 control Fig. 6 from Zhao et al., 2019
whole organism loxa expression amount, ameliorated atp7ahza4/hza4 chemical treatment: copper(2+) Fig. 7 with image from Zhao et al., 2020
intestine slc15a1b expression decreased amount, abnormal atp7ahza4/hza4 chemical treatment: copper atom Fig. 6 from Zhao et al., 2019
Citations