CRISPR

CRISPR1-fndc3a

ID
ZDB-CRISPR-200313-1
Name
CRISPR1-fndc3a
Previous Names
None
Target
Sequence
5' - GGATTCCAGGCCAGTTATGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
wue1 fndc3a
Expression
Gene expression in Wild Types + CRISPR1-fndc3a
No data available
Phenotype
Phenotype resulting from CRISPR1-fndc3a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-fndc3a
Phenotype Fish Conditions Figures
caudal fin hmcn2 expression spatial pattern, abnormal fndc3awue1/wue1 standard conditions Figure 3 with image from Liedtke et al., 2019
caudal fin deformed, abnormal fndc3awue1/wue1 standard conditions Fig. S7Fig. S8Figure 2 with image from Liedtke et al., 2019
regenerating fin morphology, abnormal fndc3awue1/wue1 amputation: caudal fin Figure 6 with image from Liedtke et al., 2019
tail bud fgf8a expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
tail bud hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Figure 3 with image from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S7 from Liedtke et al., 2019
median fin fold decreased width, abnormal fndc3awue1/wue1 standard conditions Fig. S8Figure 4 with image from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S7 from Liedtke et al., 2019
caudal fin actinotrichium decreased amount, abnormal fndc3awue1/wue1 standard conditions Figure 4 with image from Liedtke et al., 2019
caudal fin hmcn2 expression increased distribution, abnormal fndc3awue1/wue1 standard conditions Figure 3 with image from Liedtke et al., 2019
ventral fin fold epidermal basal stratum malformed, abnormal fndc3awue1/wue1 standard conditions Figure 4 with image from Liedtke et al., 2019
post-vent region myod1 expression increased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
post-vent region malformed, abnormal fndc3awue1/wue1 standard conditions Figure 2 with image from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold actinotrichium decreased amount, abnormal fndc3awue1/wue1 standard conditions Figure 4 with image from Liedtke et al., 2019
median fin fold fras1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S8 from Liedtke et al., 2019
chordo neural hinge shha expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
ventral fin fold actinotrichium morphology, abnormal fndc3awue1/wue1 standard conditions Figure 4 with image from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S7 from Liedtke et al., 2019
notochord tbxta expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
caudal fin actinotrichium morphology, abnormal fndc3awue1/wue1 standard conditions Figure 4 with image from Liedtke et al., 2019
median fin fold hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S8 from Liedtke et al., 2019
post-vent region myod1 expression mislocalised, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
post-vent region kinked, abnormal fndc3awue1/wue1 standard conditions Figure 2 with image from Liedtke et al., 2019
caudal fin fras1 expression spatial pattern, abnormal fndc3awue1/wue1 standard conditions Figure 3 with image from Liedtke et al., 2019
somite fgf8a expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
tail bud tbxta expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
ventral fin fold Ab13-smad labeling decreased amount, abnormal fndc3awue1/wue1 standard conditions Figure 7 with image from Liedtke et al., 2019
ventral fin fold decreased width, abnormal fndc3awue1/wue1 standard conditions Fig. S7Fig. S8Figure 4 with image from Liedtke et al., 2019
notochord shha expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S6 from Liedtke et al., 2019
ventral fin fold extracellular matrix morphology, abnormal fndc3awue1/wue1 standard conditions Figure 6 with image from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S7 from Liedtke et al., 2019
dorsal fin fold decreased width, abnormal fndc3awue1/wue1 standard conditions Figure 4 with image from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold and1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Figure 3 with image from Liedtke et al., 2019
median fin fold hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S8 from Liedtke et al., 2019
regenerating fin extracellular matrix structure, abnormal fndc3awue1/wue1 amputation: caudal fin Figure 6 with image from Liedtke et al., 2019
median fin fold Ab1-fndc3a labeling decreased amount, abnormal fndc3awue1/wue1 standard conditions Fig. S3 from Liedtke et al., 2019
tail bud straight, abnormal fndc3awue1/wue1 standard conditions Figure 2 with image from Liedtke et al., 2019
caudal fin malformed, abnormal fndc3awue1/wue1 standard conditions Figure 2 with image from Liedtke et al., 2019
tail bud fras1 expression decreased amount, abnormal fndc3awue1/wue1 standard conditions Figure 3 with image from Liedtke et al., 2019
caudal fin kinked, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold decreased width, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold fras1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold mesenchyme hmcn2 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
ventral fin fold hmcn1 expression decreased amount, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
caudal fin deformed, abnormal fndc3awue1/wue1 + MO1-fndc3a standard conditions Fig. S7 from Liedtke et al., 2019
Citations