CRISPR

CRISPR1-scxa

ID
ZDB-CRISPR-191227-3
Name
CRISPR1-scxa
Previous Names
None
Target
Sequence
5' - GGGGGTGGCGGACGGCTGAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
kg141 scxa
kg170 scxa
Expression
Gene expression in Wild Types + CRISPR1-scxa
No data available
Phenotype
Phenotype resulting from CRISPR1-scxa
No data available
Phenotype of all Fish created by or utilizing CRISPR1-scxa
Phenotype Fish Conditions Figures
dentary decreased mass density, abnormal scxakg170/kg170 (AB) standard conditions Fig. 4 with image from Kague et al., 2019
ventral intermandibularis posterior tendon malformed, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
rib of vertebra 5 absent, abnormal scxakg170/kg170 (AB) standard conditions Fig. 5 with image from Kague et al., 2019
Meckel's cartilage ligament tnmd expression decreased amount, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
vertical myoseptum muscle tendon junction tnmd expression decreased amount, abnormal scxakg170/kg170 (AB) standard conditions Fig. 6 with image from Kague et al., 2019
female organism decreased weight, abnormal scxakg170/kg170 (AB) standard conditions Fig. 3 with image from Kague et al., 2019
rib of vertebra 6 absent, abnormal scxakg170/kg170 (AB) standard conditions Fig. 5 with image from Kague et al., 2019
dentary composition, abnormal scxakg170/kg170 (AB) standard conditions Fig. 4 with image from Kague et al., 2019
rib bone mineralization decreased process quality, abnormal scxakg170/kg170 (AB) standard conditions Fig. 4 with imageFig. 5 with image from Kague et al., 2019
swimming decreased process quality, abnormal scxakg170/kg170 (AB) standard conditions Fig. 3 with image from Kague et al., 2019
male organism decreased weight, abnormal scxakg170/kg170 (AB) standard conditions Fig. 3 with image from Kague et al., 2019
splanchnocranium tendon development decreased process quality, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
adductor mandibulae skeletal muscle cell mislocalised, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
interhyoideus tendon malformed, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
palatoquadrate cartilage ligament tnmd expression decreased amount, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
intervertebral ligament malformed, abnormal scxakg170/kg170 (AB) standard conditions Fig. 4 with image from Kague et al., 2019
interhyoideus skeletal muscle cell mislocalised, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
myotome decreased volume, abnormal scxakg170/kg170 (AB) standard conditions Fig. 3 with image from Kague et al., 2019
skeletal system lacks parts or has fewer parts of type rib, abnormal scxakg170/kg170 (AB) standard conditions Fig. 5 with image from Kague et al., 2019
ceratohyal cartilage tendon malformed, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
skeletal system lacks all parts of type rib, abnormal scxakg170/kg170 (AB) standard conditions Fig. 3 with imageFig. 4 with image from Kague et al., 2019
sternohyoid tendon tnmd expression decreased amount, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
rib bone morphogenesis decreased process quality, abnormal scxakg170/kg170 (AB) standard conditions Fig. 4 with imageFig. 5 with image from Kague et al., 2019
splanchnocranium skeletal muscle tissue development decreased process quality, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
hyohyoideus skeletal muscle cell mislocalised, abnormal scxakg170/kg170 (AB) standard conditions Fig. 2 with image from Kague et al., 2019
sternohyoid tendon composition, abnormal scxakg170/kg170; hu5910Tg (AB) standard conditions Fig. 2 with image from Kague et al., 2019
splanchnocranium tendon development decreased process quality, abnormal scxakg170/kg170; hu5910Tg (AB) standard conditions Fig. 2 with image from Kague et al., 2019
splanchnocranium skeletal muscle tissue development decreased process quality, abnormal scxakg170/kg170; hu5910Tg (AB) standard conditions Fig. 2 with image from Kague et al., 2019
tendon collagen fibril organization decreased process quality, abnormal scxakg170/kg170; hu5910Tg (AB) standard conditions Fig. 2 with image from Kague et al., 2019
interhyoideus skeletal muscle cell increased length, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
splanchnocranium skeletal muscle tissue development decreased process quality, exacerbated scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral intermandibularis posterior skeletal muscle cell mislocalised, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
interhyoideus tendon Ab4-thbs4b labeling decreased amount, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
splanchnocranium tendon development decreased process quality, exacerbated scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral intermandibularis posterior skeletal muscle cell increased length, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral intermandibularis posterior tendon Ab4-thbs4b labeling decreased amount, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral mandibular arch paralysed, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
adductor mandibulae tendon Ab4-thbs4b labeling decreased amount, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
interhyoideus skeletal muscle cell mislocalised, abnormal scxakg170/kg170; scxbkg107/kg107 (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte undifferentiated, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte differentiation decreased process quality, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte immature, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage drooping, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage malformed, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Meckel's cartilage chondrocyte obtuse, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
ventral mandibular arch paralysed, abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
whole organism lethal (sensu genetics), abnormal scxakg170/kg170; scxbkg107/kg107; hu5910Tg (AB) standard conditions Fig. 7 with image from Kague et al., 2019
Citations