CRISPR

CRISPR1-hdac4

ID
ZDB-CRISPR-190627-1
Name
CRISPR1-hdac4
Previous Names
None
Target
Sequence
5' - GGAGCGTCATCGACAGGAGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
aik2 hdac4
aik3 hdac4
Expression
Gene expression in Wild Types + CRISPR1-hdac4
No data available
Phenotype
Phenotype resulting from CRISPR1-hdac4
No data available
Phenotype of all Fish created by or utilizing CRISPR1-hdac4
Phenotype Fish Conditions Figures
female organism viability, abnormal hdac4aik2/aik2 (AB) standard conditions text only from DeLaurier et al., 2019
ossification premature, abnormal hdac4aik2/aik2 (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
female organism absent, abnormal hdac4aik2/aik2 (AB) standard conditions text only from DeLaurier et al., 2019
ceratohyal cartilage ossification premature, abnormal hdac4aik2/aik2 (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
ceratohyal bone irregularly shaped, abnormal hdac4aik2/aik2 (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
ceratohyal cartilage postero-medial margin runx2a expression increased amount, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 4 with image from DeLaurier et al., 2019
ventral mandibular arch lacks parts or has fewer parts of type Meckel's cartilage, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ceratohyal cartilage postero-medial margin runx2b expression increased amount, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 4 with image from DeLaurier et al., 2019
ceratobranchial 2 cartilage ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
neurocranium malformed, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ventral hypohyal bone ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
neurocranium morphology, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
palatoquadrate cartilage anterior region decreased size, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ceratohyal cartilage ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
ceratohyal cartilage ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
quadrate decreased size, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
symplectic ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
quadrate ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
mandibular arch skeleton decreased length, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ceratohyal bone irregularly shaped, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
head decreased length, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
entopterygoid decreased size, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
anguloarticular ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
ceratobranchial 1 cartilage ossification premature, abnormal hdac4aik3/aik3 (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
ventral mandibular arch lacks parts or has fewer parts of type Meckel's cartilage, abnormal hdac4aik3/+ (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ossification premature, abnormal hdac4aik3/+ (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
neurocranium morphology, abnormal hdac4aik3/+ (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ventral hypohyal bone ossification premature, abnormal hdac4aik3/+ (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
ceratohyal cartilage ossification premature, abnormal hdac4aik3/+ (AB) standard conditions Fig. 2 with image from DeLaurier et al., 2019
symplectic ossification premature, abnormal hdac4aik3/+ (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
palatoquadrate cartilage anterior region decreased size, abnormal hdac4aik3/+ (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
ceratohyal cartilage ossification premature, abnormal hdac4aik3/+ (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
quadrate decreased size, abnormal hdac4aik3/+ (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
entopterygoid decreased size, abnormal hdac4aik3/+ (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
neurocranium hypertrophic, abnormal hdac4aik3/+ (AB) standard conditions Fig. 6 with image from DeLaurier et al., 2019
anguloarticular ossification premature, abnormal hdac4aik3/+ (AB) standard conditions Fig. 5 with image from DeLaurier et al., 2019
Citations