CRISPR

CRISPR2-spaw

ID
ZDB-CRISPR-190422-2
Name
CRISPR2-spaw
Previous Names
None
Target
Sequence
5' - GTACCTTGGATAAAACTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
a205 spaw
Expression
Gene expression in Wild Types + CRISPR2-spaw
No data available
Phenotype
Phenotype resulting from CRISPR2-spaw
No data available
Phenotype of all Fish created by or utilizing CRISPR2-spaw
Phenotype Fish Conditions Figures
Kupffer's vesicle anatomical region spaw expression decreased amount, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging process quality, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping decreased occurrence, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord lft1 expression absent, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm spaw expression absent, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 3 from Montague et al., 2018
heart looping process quality, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging decreased occurrence, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart primordium lft2 expression absent, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression absent, abnormal spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging process quality, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord lft1 expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping decreased occurrence, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm spaw expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 3 from Montague et al., 2018
heart jogging decreased occurrence, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping process quality, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
Kupffer's vesicle anatomical region spaw expression decreased amount, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart primordium lft2 expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression absent, abnormal dand5a204/a204; spawa205/a205 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart jogging process quality, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
notochord lft1 expression absent, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping decreased occurrence, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
lateral plate mesoderm spaw expression absent, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 3 from Montague et al., 2018
heart jogging decreased occurrence, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart looping process quality, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
Kupffer's vesicle anatomical region spaw expression decreased amount, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
heart primordium lft2 expression absent, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
whole organism medial region lft1 expression absent, abnormal spawa205/a205; lft1a145/a145 (AB/TL) standard conditions Fig. 1 with image from Montague et al., 2018
Citations