CRISPR

CRISPR1-fanca

ID

ZDB-CRISPR-190417-1

Name

CRISPR1-fanca

Previous Names

None

Target

fanca (1)

Sequence

5' - GGCGCGGCAGGCGGCTCTCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg40	fanca
hg41	fanca

Expression

Gene expression in Wild Types + CRISPR1-fanca

No data available

Phenotype

Phenotype resulting from CRISPR1-fanca

No data available

Phenotype of all Fish created by or utilizing CRISPR1-fanca

Phenotype	Fish	Conditions	Figures
male organism increased amount, abnormal	fanca^hg40/hg40	standard conditions	Fig. S10 from Ramanagoudr-Bhojappa et al., 2018
female sex determination decreased occurrence, abnormal	fanca^hg40/hg40	standard conditions	Fig. S10 from Ramanagoudr-Bhojappa et al., 2018
female organism decreased amount, abnormal	fanca^hg40/hg40	standard conditions	Fig. S10 from Ramanagoudr-Bhojappa et al., 2018
male sex determination increased occurrence, abnormal	fanca^hg40/hg40	standard conditions	Fig. S10 from Ramanagoudr-Bhojappa et al., 2018
whole organism morphology, ameliorated	fanca^hg41/hg41	chemical treatment by environment: diepoxybutane	Fig. 2 from Ramanagoudr-Bhojappa et al., 2018
female organism decreased amount, abnormal	fanca^hg41/hg41	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
male organism increased amount, abnormal	fanca^hg41/hg41	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
female sex determination decreased occurrence, abnormal	fanca^hg41/hg41	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
response to xenobiotic stimulus process quality, ameliorated	fanca^hg41/hg41	chemical treatment by environment: diepoxybutane	Fig. 2 from Ramanagoudr-Bhojappa et al., 2018
male sex determination increased occurrence, abnormal	fanca^hg41/hg41	standard conditions	Fig. 5 from Ramanagoudr-Bhojappa et al., 2018
leukocyte decreased amount, abnormal	fanca^hg41/hg41 (NHGRI-1)	standard conditions	Fig. 1 from Raman et al., 2021
caudal artery blood coagulation decreased process quality, abnormal	fanca^hg41/hg41 (NHGRI-1)	chemical treatment by environment: diepoxybutane, light damage: caudal vein	Fig. 3 from Raman et al., 2021
caudal artery blood coagulation decreased process quality, abnormal	fanca^hg41/hg41 (NHGRI-1)	light damage: caudal artery	Fig. 3 from Raman et al., 2021
nucleate erythrocyte decreased amount, abnormal	fanca^hg41/hg41 (NHGRI-1)	standard conditions	Fig. 1 from Raman et al., 2021
caudal artery blood coagulation decreased process quality, abnormal	fanca^hg41/hg41 (NHGRI-1)	chemical treatment by environment: diepoxybutane, light damage: caudal artery	Fig. 3 from Raman et al., 2021
caudal vein blood coagulation increased process quality, abnormal	fanca^hg41/hg41 (NHGRI-1)	light damage: caudal vein	Fig. 3 from Raman et al., 2021
nucleate erythrocyte decreased ratio blood plasma, abnormal	fanca^hg41/hg41 (NHGRI-1)	standard conditions	Fig. 2 from Raman et al., 2021
whole organism morphology, ameliorated	fanca^hg41/+	chemical treatment by environment: diepoxybutane	Fig. 2 from Ramanagoudr-Bhojappa et al., 2018
response to xenobiotic stimulus process quality, ameliorated	fanca^hg41/+	chemical treatment by environment: diepoxybutane	Fig. 2 from Ramanagoudr-Bhojappa et al., 2018

Citations