CRISPR

CRISPR1-cftr

ID
ZDB-CRISPR-181109-2
Name
CRISPR1-cftr
Previous Names
None
Target
Sequence
5' - GGATGCAGAGATCACCTGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
scu101 cftr
Expression
Gene expression in Wild Types + CRISPR1-cftr
No data available
Phenotype
Phenotype resulting from CRISPR1-cftr
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cftr
Phenotype Fish Conditions Figures
whole organism smyhc2 expression increased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
heart contraction decreased rate of occurrence, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
heart edematous, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
heart dysplastic, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
atrium dilated, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
whole organism si:ch211-211k8.4 expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
heart looping process quality, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
whole organism hip1ra expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism tpm4b expression increased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism itgb1b.1 expression increased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism itgbl1 expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism has2 expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
heart has2 expression decreased distribution, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
whole organism nkx2.5 expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
whole organism cacna2d2a expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism atp2a2a expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
lateral mesoderm nkx2.5 expression decreased distribution, abnormal cftrscu101/scu101 standard conditions Fig. 1 with imageFig. 4 with image from Liu et al., 2020
whole organism itga10 expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism mamdc2b expression increased amount, abnormal cftrscu101/scu101 standard conditions Fig. 3 from Liu et al., 2020
whole organism bmp4 expression decreased amount, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
heart bmp4 expression decreased distribution, abnormal cftrscu101/scu101 standard conditions Fig. 1 with image from Liu et al., 2020
primordial germ cell mislocalised, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with image from Liao et al., 2018
whole organism rgs14a expression increased amount, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 5 with image from Liao et al., 2018
whole organism cxcr4b expression increased amount, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 5 with image from Liao et al., 2018
whole organism cftr expression decreased amount, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 1 with image from Liao et al., 2018
germ cell migration decreased occurrence, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 2 with imageFig. 4 with imageFig. 5 with image from Liao et al., 2018
whole organism cxcl12a expression increased amount, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 5 with image from Liao et al., 2018
tail bud lacks all parts of type Kupffer's vesicle, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 1 with image from Liao et al., 2018
Kupffer's vesicle development arrested, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 1 with image from Liao et al., 2018
whole organism ca15b expression increased amount, abnormal cftrscu101/scu101 (AB) standard conditions Fig. 5 with image from Liao et al., 2018
Citations